Incidental Mutation 'R0836:Bptf'
ID 77938
Institutional Source Beutler Lab
Gene Symbol Bptf
Ensembl Gene ENSMUSG00000040481
Gene Name bromodomain PHD finger transcription factor
Synonyms Falz, 9430093H17Rik
MMRRC Submission 039015-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0836 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 106923907-107022953 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 107001638 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057892] [ENSMUST00000106762] [ENSMUST00000106763]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000057892
SMART Domains Protein: ENSMUSP00000052303
Gene: ENSMUSG00000040481

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
coiled coil region 864 894 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 987 998 N/A INTRINSIC
low complexity region 1062 1072 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1225 1238 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1491 1503 N/A INTRINSIC
low complexity region 1594 1613 N/A INTRINSIC
low complexity region 1636 1645 N/A INTRINSIC
low complexity region 1665 1683 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
coiled coil region 1908 1936 N/A INTRINSIC
low complexity region 1941 1957 N/A INTRINSIC
low complexity region 2051 2061 N/A INTRINSIC
low complexity region 2092 2107 N/A INTRINSIC
low complexity region 2115 2128 N/A INTRINSIC
low complexity region 2175 2197 N/A INTRINSIC
low complexity region 2227 2252 N/A INTRINSIC
low complexity region 2275 2312 N/A INTRINSIC
low complexity region 2336 2355 N/A INTRINSIC
low complexity region 2361 2378 N/A INTRINSIC
low complexity region 2390 2420 N/A INTRINSIC
low complexity region 2430 2463 N/A INTRINSIC
coiled coil region 2489 2527 N/A INTRINSIC
coiled coil region 2576 2604 N/A INTRINSIC
low complexity region 2663 2700 N/A INTRINSIC
low complexity region 2713 2736 N/A INTRINSIC
PHD 2744 2791 5.32e-9 SMART
BROMO 2800 2908 5.5e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106762
SMART Domains Protein: ENSMUSP00000102373
Gene: ENSMUSG00000040481

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
internal_repeat_1 589 642 6.48e-5 PROSPERO
low complexity region 644 654 N/A INTRINSIC
low complexity region 662 679 N/A INTRINSIC
coiled coil region 926 956 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1039 1050 N/A INTRINSIC
low complexity region 1114 1124 N/A INTRINSIC
low complexity region 1138 1150 N/A INTRINSIC
low complexity region 1277 1290 N/A INTRINSIC
low complexity region 1303 1317 N/A INTRINSIC
internal_repeat_1 1387 1440 6.48e-5 PROSPERO
low complexity region 1543 1555 N/A INTRINSIC
low complexity region 1646 1665 N/A INTRINSIC
low complexity region 1688 1697 N/A INTRINSIC
low complexity region 1717 1735 N/A INTRINSIC
low complexity region 1870 1886 N/A INTRINSIC
coiled coil region 1960 1988 N/A INTRINSIC
low complexity region 1993 2009 N/A INTRINSIC
low complexity region 2103 2113 N/A INTRINSIC
low complexity region 2144 2159 N/A INTRINSIC
low complexity region 2167 2180 N/A INTRINSIC
low complexity region 2227 2249 N/A INTRINSIC
low complexity region 2279 2304 N/A INTRINSIC
low complexity region 2327 2364 N/A INTRINSIC
low complexity region 2388 2407 N/A INTRINSIC
low complexity region 2413 2430 N/A INTRINSIC
low complexity region 2442 2472 N/A INTRINSIC
low complexity region 2482 2515 N/A INTRINSIC
coiled coil region 2541 2579 N/A INTRINSIC
coiled coil region 2628 2656 N/A INTRINSIC
low complexity region 2715 2752 N/A INTRINSIC
low complexity region 2765 2788 N/A INTRINSIC
PHD 2796 2843 5.32e-9 SMART
BROMO 2852 2960 5.5e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106763
SMART Domains Protein: ENSMUSP00000102374
Gene: ENSMUSG00000040481

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.9e-8 PFAM
PHD 404 447 2.23e-11 SMART
low complexity region 624 639 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 725 742 N/A INTRINSIC
coiled coil region 989 1019 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1177 1187 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1366 1380 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1709 1728 N/A INTRINSIC
low complexity region 1751 1760 N/A INTRINSIC
low complexity region 1780 1798 N/A INTRINSIC
low complexity region 1933 1949 N/A INTRINSIC
coiled coil region 2023 2051 N/A INTRINSIC
low complexity region 2056 2072 N/A INTRINSIC
low complexity region 2166 2176 N/A INTRINSIC
low complexity region 2207 2222 N/A INTRINSIC
low complexity region 2230 2243 N/A INTRINSIC
low complexity region 2290 2312 N/A INTRINSIC
low complexity region 2342 2367 N/A INTRINSIC
low complexity region 2390 2427 N/A INTRINSIC
low complexity region 2451 2470 N/A INTRINSIC
low complexity region 2476 2493 N/A INTRINSIC
low complexity region 2505 2535 N/A INTRINSIC
low complexity region 2545 2578 N/A INTRINSIC
coiled coil region 2604 2642 N/A INTRINSIC
coiled coil region 2691 2719 N/A INTRINSIC
low complexity region 2778 2815 N/A INTRINSIC
low complexity region 2828 2851 N/A INTRINSIC
PHD 2859 2906 5.32e-9 SMART
BROMO 2915 3023 5.5e-37 SMART
Meta Mutation Damage Score 0.9596 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.2%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with embryonic growth arrest around early gastrulation and a greatly reduced ectoplacental cone. [provided by MGI curators]
Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(56)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik A G 5: 139,349,875 (GRCm39) V58A possibly damaging Het
4932415M13Rik A T 17: 54,031,374 (GRCm39) noncoding transcript Het
A930003A15Rik T C 16: 19,702,622 (GRCm39) noncoding transcript Het
Abca8a A T 11: 109,931,390 (GRCm39) D1253E possibly damaging Het
Acsm3 T C 7: 119,376,323 (GRCm39) I350T possibly damaging Het
Adcy9 T C 16: 4,237,135 (GRCm39) D92G possibly damaging Het
Aldh9a1 G A 1: 167,177,824 (GRCm39) G7D probably benign Het
Alg14 A G 3: 121,092,259 (GRCm39) H34R probably damaging Het
Ankrd27 A G 7: 35,307,772 (GRCm39) N337S probably damaging Het
Apoa2 T A 1: 171,052,948 (GRCm39) probably benign Het
Asphd2 A T 5: 112,539,635 (GRCm39) L66H probably damaging Het
Astl T C 2: 127,184,339 (GRCm39) F21L probably benign Het
Cacna2d4 C T 6: 119,284,247 (GRCm39) R745W probably damaging Het
Cadps2 T C 6: 23,328,775 (GRCm39) probably benign Het
Camk4 G T 18: 33,072,507 (GRCm39) S20I unknown Het
Ccdc85a T A 11: 28,533,296 (GRCm39) I83F probably damaging Het
Ccnt2 T A 1: 127,730,131 (GRCm39) M336K probably benign Het
Cd209e G T 8: 3,903,205 (GRCm39) D62E probably benign Het
Ceacam23 C A 7: 17,638,906 (GRCm39) A301E possibly damaging Het
Ces1f A T 8: 93,996,652 (GRCm39) S214T probably damaging Het
Cfap43 C A 19: 47,804,285 (GRCm39) V304L probably benign Het
Col26a1 A G 5: 136,794,154 (GRCm39) probably null Het
Cpa5 T C 6: 30,623,210 (GRCm39) S124P probably damaging Het
Crtc1 A G 8: 70,845,663 (GRCm39) V306A probably benign Het
D130043K22Rik G A 13: 25,047,563 (GRCm39) probably benign Het
D17H6S53E A T 17: 35,346,385 (GRCm39) probably null Het
Dmxl1 T C 18: 49,966,215 (GRCm39) V20A probably damaging Het
Dnah11 G A 12: 118,160,397 (GRCm39) A111V probably benign Het
Dyrk2 T C 10: 118,697,027 (GRCm39) H77R probably benign Het
Epha3 A G 16: 63,423,882 (GRCm39) probably benign Het
Epn2 T C 11: 61,410,317 (GRCm39) N611S probably benign Het
Erich6 A C 3: 58,526,365 (GRCm39) probably benign Het
Fam217b T C 2: 178,062,782 (GRCm39) S249P probably benign Het
Fezf1 T C 6: 23,246,998 (GRCm39) H278R probably benign Het
Fhod3 T A 18: 25,199,275 (GRCm39) Y649N probably damaging Het
Ftdc2 G A 16: 58,455,886 (GRCm39) S129L probably damaging Het
Grap T A 11: 61,551,065 (GRCm39) D32E possibly damaging Het
Hipk1 A G 3: 103,661,612 (GRCm39) S670P probably damaging Het
Iho1 A T 9: 108,282,000 (GRCm39) C563S probably benign Het
Ilrun A T 17: 28,005,112 (GRCm39) S148R probably damaging Het
Itga2 A G 13: 114,993,215 (GRCm39) V800A probably damaging Het
Itgae A T 11: 73,020,032 (GRCm39) M845L probably benign Het
Itgb5 A G 16: 33,720,953 (GRCm39) K339R probably damaging Het
Itpka T A 2: 119,581,312 (GRCm39) N448K probably damaging Het
Jak3 A C 8: 72,136,622 (GRCm39) N643T probably damaging Het
Kcnd2 T A 6: 21,727,328 (GRCm39) V627E probably damaging Het
Kcnd2 T C 6: 21,726,238 (GRCm39) probably benign Het
Ktn1 A G 14: 47,938,519 (GRCm39) probably null Het
Lamp1 T A 8: 13,222,654 (GRCm39) F279L probably damaging Het
Macf1 A G 4: 123,388,675 (GRCm39) probably null Het
Mark2 A G 19: 7,263,189 (GRCm39) Y193H probably damaging Het
Mcrs1 T C 15: 99,141,330 (GRCm39) probably benign Het
Mtnr1a A T 8: 45,540,974 (GRCm39) I312F probably benign Het
Myom2 A T 8: 15,182,924 (GRCm39) K1454* probably null Het
Nfkbia C A 12: 55,537,561 (GRCm39) A211S probably damaging Het
Or52ae9 T C 7: 103,390,132 (GRCm39) H105R probably damaging Het
Or56b1b T C 7: 108,164,205 (GRCm39) T266A possibly damaging Het
Or8b1c A T 9: 38,384,081 (GRCm39) I13F probably benign Het
Otog C T 7: 45,918,786 (GRCm39) T954I possibly damaging Het
Phlpp2 A G 8: 110,663,738 (GRCm39) T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,066,107 (GRCm39) probably benign Het
Plekha5 T A 6: 140,535,360 (GRCm39) probably benign Het
Pmch A G 10: 87,927,086 (GRCm39) I30V probably benign Het
Ppat A C 5: 77,070,348 (GRCm39) Y157D probably benign Het
Ppp1r16a C T 15: 76,577,869 (GRCm39) Q328* probably null Het
Rab27b T C 18: 70,120,112 (GRCm39) probably benign Het
Rapsn T C 2: 90,867,153 (GRCm39) Y152H probably damaging Het
Rasd1 A T 11: 59,855,379 (GRCm39) F85I probably damaging Het
Rbp3 T G 14: 33,678,595 (GRCm39) S848A possibly damaging Het
Rgs1 A T 1: 144,123,671 (GRCm39) S85T probably damaging Het
Rictor A G 15: 6,793,759 (GRCm39) probably null Het
Rims1 T C 1: 22,497,709 (GRCm39) probably null Het
Shc1 A G 3: 89,330,276 (GRCm39) D70G probably damaging Het
Slc22a28 T C 19: 8,094,197 (GRCm39) Y245C possibly damaging Het
Slc25a1 T A 16: 17,745,300 (GRCm39) H78L probably benign Het
Slc30a7 T A 3: 115,783,789 (GRCm39) probably null Het
Slc34a2 A G 5: 53,225,049 (GRCm39) T397A probably benign Het
Slc51a T A 16: 32,294,667 (GRCm39) T306S probably benign Het
Sorcs3 G A 19: 48,475,833 (GRCm39) V231I probably benign Het
Sp100 A T 1: 85,627,465 (GRCm39) I86L probably damaging Het
Spata31e5 A G 1: 28,816,902 (GRCm39) S377P possibly damaging Het
Stard9 T G 2: 120,527,480 (GRCm39) S1246A possibly damaging Het
Stxbp5 A T 10: 9,740,843 (GRCm39) S116R probably damaging Het
Tas2r105 T C 6: 131,664,393 (GRCm39) I12V probably benign Het
Tas2r121 A G 6: 132,677,325 (GRCm39) S216P probably damaging Het
Tax1bp1 C T 6: 52,718,925 (GRCm39) probably benign Het
Tcof1 T C 18: 60,978,904 (GRCm39) D48G probably damaging Het
Tex24 A T 8: 27,834,748 (GRCm39) H92L possibly damaging Het
Tgm3 C T 2: 129,868,602 (GRCm39) probably benign Het
Thbs4 T G 13: 92,894,546 (GRCm39) D659A probably damaging Het
Tmed11 A T 5: 108,943,175 (GRCm39) M1K probably null Het
Tmpo A T 10: 90,997,815 (GRCm39) C657* probably null Het
Unc5a C A 13: 55,151,746 (GRCm39) N56K possibly damaging Het
Urb1 T C 16: 90,592,336 (GRCm39) D308G possibly damaging Het
Vav3 A G 3: 109,554,995 (GRCm39) N81S possibly damaging Het
Vmn2r108 A T 17: 20,691,721 (GRCm39) D267E probably benign Het
Vmn2r17 A T 5: 109,575,822 (GRCm39) H231L possibly damaging Het
Wrn A G 8: 33,785,034 (GRCm39) I446T possibly damaging Het
Zfp266 G A 9: 20,411,095 (GRCm39) H361Y probably damaging Het
Other mutations in Bptf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Bptf APN 11 106,946,105 (GRCm39) missense possibly damaging 0.88
IGL00664:Bptf APN 11 106,968,491 (GRCm39) missense possibly damaging 0.78
IGL00705:Bptf APN 11 106,986,534 (GRCm39) splice site probably benign
IGL00796:Bptf APN 11 106,945,376 (GRCm39) missense probably damaging 1.00
IGL00834:Bptf APN 11 106,964,754 (GRCm39) missense possibly damaging 0.59
IGL01155:Bptf APN 11 106,971,553 (GRCm39) missense probably damaging 1.00
IGL01314:Bptf APN 11 106,945,679 (GRCm39) missense probably damaging 1.00
IGL01371:Bptf APN 11 106,946,733 (GRCm39) missense probably benign 0.00
IGL01567:Bptf APN 11 106,949,600 (GRCm39) missense probably damaging 1.00
IGL01794:Bptf APN 11 106,944,047 (GRCm39) critical splice donor site probably null
IGL02108:Bptf APN 11 106,965,814 (GRCm39) missense probably benign 0.45
IGL02367:Bptf APN 11 106,964,178 (GRCm39) missense probably benign
IGL02437:Bptf APN 11 106,965,521 (GRCm39) missense probably benign 0.00
IGL02589:Bptf APN 11 107,002,357 (GRCm39) missense possibly damaging 0.92
IGL02897:Bptf APN 11 106,937,947 (GRCm39) missense probably damaging 1.00
IGL02935:Bptf APN 11 106,971,625 (GRCm39) missense probably damaging 1.00
IGL02954:Bptf APN 11 106,945,575 (GRCm39) missense possibly damaging 0.89
IGL02982:Bptf APN 11 106,967,500 (GRCm39) missense probably damaging 1.00
IGL03109:Bptf APN 11 106,952,527 (GRCm39) missense possibly damaging 0.53
IGL03265:Bptf APN 11 106,945,454 (GRCm39) missense probably benign 0.00
IGL03403:Bptf APN 11 106,990,559 (GRCm39) missense possibly damaging 0.51
Anodyne UTSW 11 106,934,457 (GRCm39) critical splice donor site probably null
Arroyo UTSW 11 106,933,516 (GRCm39) missense probably benign 0.32
mojado UTSW 11 106,935,466 (GRCm39) missense probably benign 0.03
IGL03097:Bptf UTSW 11 106,968,506 (GRCm39) missense probably damaging 1.00
PIT4486001:Bptf UTSW 11 106,945,614 (GRCm39) missense probably damaging 0.98
R0066:Bptf UTSW 11 106,952,962 (GRCm39) missense possibly damaging 0.90
R0157:Bptf UTSW 11 106,965,484 (GRCm39) missense possibly damaging 0.89
R0320:Bptf UTSW 11 106,963,645 (GRCm39) missense probably damaging 1.00
R0328:Bptf UTSW 11 106,937,953 (GRCm39) missense probably damaging 1.00
R0402:Bptf UTSW 11 106,964,940 (GRCm39) missense probably damaging 1.00
R0482:Bptf UTSW 11 106,972,088 (GRCm39) missense probably benign 0.13
R0574:Bptf UTSW 11 106,967,353 (GRCm39) missense probably damaging 1.00
R0598:Bptf UTSW 11 106,963,791 (GRCm39) missense probably damaging 0.99
R0599:Bptf UTSW 11 106,959,208 (GRCm39) missense probably damaging 1.00
R0601:Bptf UTSW 11 106,952,518 (GRCm39) missense probably benign 0.04
R0744:Bptf UTSW 11 107,001,638 (GRCm39) critical splice donor site probably null
R0885:Bptf UTSW 11 106,934,617 (GRCm39) missense probably damaging 1.00
R1070:Bptf UTSW 11 106,945,881 (GRCm39) missense possibly damaging 0.92
R1252:Bptf UTSW 11 106,964,077 (GRCm39) missense probably benign 0.00
R1370:Bptf UTSW 11 106,937,920 (GRCm39) missense probably damaging 0.99
R1428:Bptf UTSW 11 106,963,873 (GRCm39) missense probably damaging 0.99
R1467:Bptf UTSW 11 106,945,881 (GRCm39) missense possibly damaging 0.92
R1467:Bptf UTSW 11 106,945,881 (GRCm39) missense possibly damaging 0.92
R1742:Bptf UTSW 11 107,001,777 (GRCm39) missense probably damaging 1.00
R1816:Bptf UTSW 11 106,951,405 (GRCm39) missense probably damaging 1.00
R1858:Bptf UTSW 11 106,964,127 (GRCm39) missense probably benign 0.00
R1989:Bptf UTSW 11 106,965,652 (GRCm39) missense probably damaging 1.00
R2253:Bptf UTSW 11 107,002,148 (GRCm39) missense probably damaging 1.00
R2392:Bptf UTSW 11 106,963,573 (GRCm39) missense probably damaging 1.00
R2431:Bptf UTSW 11 106,938,066 (GRCm39) missense possibly damaging 0.48
R3022:Bptf UTSW 11 107,002,463 (GRCm39) critical splice acceptor site probably null
R3161:Bptf UTSW 11 106,965,302 (GRCm39) missense probably damaging 1.00
R3686:Bptf UTSW 11 106,965,024 (GRCm39) missense probably benign 0.25
R3687:Bptf UTSW 11 106,965,024 (GRCm39) missense probably benign 0.25
R3688:Bptf UTSW 11 106,965,024 (GRCm39) missense probably benign 0.25
R3787:Bptf UTSW 11 106,964,653 (GRCm39) missense probably damaging 1.00
R3834:Bptf UTSW 11 106,964,683 (GRCm39) missense probably benign 0.05
R3885:Bptf UTSW 11 106,965,339 (GRCm39) missense probably damaging 0.97
R4090:Bptf UTSW 11 106,972,349 (GRCm39) missense probably damaging 0.99
R4398:Bptf UTSW 11 107,001,670 (GRCm39) missense probably damaging 1.00
R4437:Bptf UTSW 11 106,965,300 (GRCm39) missense possibly damaging 0.59
R4514:Bptf UTSW 11 106,968,518 (GRCm39) missense probably damaging 1.00
R4565:Bptf UTSW 11 106,963,836 (GRCm39) missense probably damaging 1.00
R4715:Bptf UTSW 11 106,938,007 (GRCm39) missense probably damaging 1.00
R4748:Bptf UTSW 11 106,986,706 (GRCm39) missense probably damaging 0.96
R4764:Bptf UTSW 11 106,934,520 (GRCm39) missense probably damaging 1.00
R4885:Bptf UTSW 11 106,965,474 (GRCm39) missense probably benign 0.39
R4901:Bptf UTSW 11 107,001,686 (GRCm39) nonsense probably null
R4995:Bptf UTSW 11 106,945,391 (GRCm39) missense probably damaging 0.98
R5057:Bptf UTSW 11 106,973,354 (GRCm39) missense probably damaging 0.98
R5120:Bptf UTSW 11 106,964,211 (GRCm39) missense probably damaging 0.99
R5320:Bptf UTSW 11 106,972,193 (GRCm39) nonsense probably null
R5329:Bptf UTSW 11 106,964,121 (GRCm39) missense probably benign 0.06
R5418:Bptf UTSW 11 107,002,120 (GRCm39) missense probably damaging 1.00
R5461:Bptf UTSW 11 106,952,590 (GRCm39) missense probably damaging 1.00
R5664:Bptf UTSW 11 106,964,525 (GRCm39) missense probably benign 0.01
R5718:Bptf UTSW 11 107,002,260 (GRCm39) missense probably damaging 1.00
R5774:Bptf UTSW 11 107,001,963 (GRCm39) missense probably damaging 1.00
R5851:Bptf UTSW 11 107,001,688 (GRCm39) missense probably damaging 1.00
R5930:Bptf UTSW 11 106,964,022 (GRCm39) missense probably damaging 1.00
R5949:Bptf UTSW 11 107,001,915 (GRCm39) missense probably damaging 0.99
R5975:Bptf UTSW 11 106,926,690 (GRCm39) utr 3 prime probably benign
R6027:Bptf UTSW 11 106,965,771 (GRCm39) missense probably damaging 1.00
R6128:Bptf UTSW 11 106,965,516 (GRCm39) missense possibly damaging 0.87
R6337:Bptf UTSW 11 106,949,605 (GRCm39) missense possibly damaging 0.89
R6407:Bptf UTSW 11 107,001,952 (GRCm39) missense probably damaging 1.00
R6470:Bptf UTSW 11 106,963,593 (GRCm39) missense probably damaging 1.00
R6487:Bptf UTSW 11 106,968,552 (GRCm39) missense probably damaging 0.99
R6501:Bptf UTSW 11 106,968,509 (GRCm39) missense probably null 1.00
R6755:Bptf UTSW 11 106,938,082 (GRCm39) missense probably benign 0.27
R6861:Bptf UTSW 11 106,953,391 (GRCm39) missense probably damaging 1.00
R6866:Bptf UTSW 11 106,964,406 (GRCm39) missense probably damaging 1.00
R6879:Bptf UTSW 11 106,933,516 (GRCm39) missense probably benign 0.32
R6927:Bptf UTSW 11 106,945,421 (GRCm39) missense probably damaging 1.00
R6944:Bptf UTSW 11 106,971,649 (GRCm39) missense probably damaging 1.00
R7082:Bptf UTSW 11 106,977,573 (GRCm39) missense probably benign 0.00
R7136:Bptf UTSW 11 106,990,541 (GRCm39) missense probably damaging 1.00
R7162:Bptf UTSW 11 106,934,457 (GRCm39) critical splice donor site probably null
R7171:Bptf UTSW 11 107,022,233 (GRCm39) missense unknown
R7193:Bptf UTSW 11 106,945,635 (GRCm39) nonsense probably null
R7210:Bptf UTSW 11 106,945,290 (GRCm39) nonsense probably null
R7221:Bptf UTSW 11 106,945,658 (GRCm39) missense probably damaging 1.00
R7316:Bptf UTSW 11 107,001,740 (GRCm39) nonsense probably null
R7316:Bptf UTSW 11 106,963,935 (GRCm39) missense probably damaging 1.00
R7422:Bptf UTSW 11 106,951,384 (GRCm39) missense probably damaging 1.00
R7454:Bptf UTSW 11 106,935,466 (GRCm39) missense probably benign 0.03
R7657:Bptf UTSW 11 106,965,555 (GRCm39) missense probably damaging 1.00
R7718:Bptf UTSW 11 106,972,282 (GRCm39) missense possibly damaging 0.65
R7827:Bptf UTSW 11 106,938,013 (GRCm39) missense probably benign 0.01
R7844:Bptf UTSW 11 106,964,887 (GRCm39) missense probably damaging 0.97
R7992:Bptf UTSW 11 107,001,709 (GRCm39) missense probably benign 0.00
R8001:Bptf UTSW 11 106,938,166 (GRCm39) nonsense probably null
R8037:Bptf UTSW 11 106,946,776 (GRCm39) missense probably damaging 1.00
R8122:Bptf UTSW 11 106,927,417 (GRCm39) critical splice acceptor site probably null
R8235:Bptf UTSW 11 106,967,458 (GRCm39) missense probably benign 0.04
R8308:Bptf UTSW 11 106,943,815 (GRCm39) missense probably damaging 0.99
R8409:Bptf UTSW 11 106,953,495 (GRCm39) missense probably damaging 1.00
R8464:Bptf UTSW 11 107,022,168 (GRCm39) missense probably benign 0.01
R8477:Bptf UTSW 11 106,943,679 (GRCm39) missense probably damaging 0.98
R8482:Bptf UTSW 11 106,934,524 (GRCm39) missense probably benign 0.19
R8515:Bptf UTSW 11 106,946,064 (GRCm39) missense possibly damaging 0.85
R8519:Bptf UTSW 11 106,952,590 (GRCm39) missense probably damaging 1.00
R8708:Bptf UTSW 11 106,964,140 (GRCm39) missense probably damaging 1.00
R8708:Bptf UTSW 11 106,964,139 (GRCm39) missense probably damaging 0.99
R8722:Bptf UTSW 11 107,022,295 (GRCm39) missense unknown
R8732:Bptf UTSW 11 106,931,206 (GRCm39) missense probably damaging 1.00
R8783:Bptf UTSW 11 107,022,357 (GRCm39) missense unknown
R8828:Bptf UTSW 11 106,945,836 (GRCm39) missense probably damaging 0.98
R9004:Bptf UTSW 11 106,945,713 (GRCm39) missense probably damaging 1.00
R9010:Bptf UTSW 11 106,964,576 (GRCm39) missense probably damaging 1.00
R9035:Bptf UTSW 11 106,963,842 (GRCm39) missense probably damaging 1.00
R9083:Bptf UTSW 11 106,959,176 (GRCm39) missense probably damaging 1.00
R9211:Bptf UTSW 11 106,946,124 (GRCm39) missense probably damaging 1.00
R9345:Bptf UTSW 11 106,971,588 (GRCm39) missense possibly damaging 0.77
R9393:Bptf UTSW 11 106,965,134 (GRCm39) missense probably benign 0.00
R9451:Bptf UTSW 11 106,935,411 (GRCm39) missense probably damaging 1.00
R9561:Bptf UTSW 11 106,964,954 (GRCm39) nonsense probably null
R9632:Bptf UTSW 11 106,952,545 (GRCm39) missense probably damaging 1.00
R9648:Bptf UTSW 11 106,943,720 (GRCm39) missense probably damaging 0.99
R9650:Bptf UTSW 11 106,935,412 (GRCm39) missense probably benign 0.15
R9658:Bptf UTSW 11 107,002,170 (GRCm39) missense probably damaging 1.00
R9775:Bptf UTSW 11 106,934,502 (GRCm39) missense probably benign 0.04
R9776:Bptf UTSW 11 106,969,396 (GRCm39) missense probably damaging 1.00
Z1088:Bptf UTSW 11 106,965,408 (GRCm39) missense probably benign 0.00
Z1176:Bptf UTSW 11 106,949,510 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGCCTGAGCTACACAGGTGAC -3'
(R):5'- TGTGTGAAGCCGCCTCTTGAAG -3'

Sequencing Primer
(F):5'- TCCTTTAACAGCAAGTAAGGCG -3'
(R):5'- AGCCGCCTCTTGAAGAAGTG -3'
Posted On 2013-10-16