Mutagenetix > Incidental Mutation

Incidental Mutation 'R0836:Itga2'

77945

Institutional Source

Beutler Lab

Gene Symbol

Itga2

Ensembl Gene

ENSMUSG00000015533

Gene Name

integrin alpha 2

Synonyms

VLA-2 receptor, alpha 2 subunit, DX5, CD49B

MMRRC Submission

039015-MU

Accession Numbers

NCBI RefSeq: NM_008396.2; MGI: 96600

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0836 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114833081-114932100 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 114856679 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 800 (V800A)

Ref Sequence

ENSEMBL: ENSMUSP00000053891 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056117]

AlphaFold

Q62469

Predicted Effect

probably damaging
Transcript: ENSMUST00000056117
AA Change: V800A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000053891
Gene: ENSMUSG00000015533
AA Change: V800A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Int_alpha	41	96	4.91e-4	SMART
VWA	169	359	2.42e-39	SMART
Blast:VWA	364	424	4e-26	BLAST
Int_alpha	430	481	2.59e-3	SMART
Int_alpha	484	541	3.5e-9	SMART
Int_alpha	547	602	3.11e-15	SMART
Int_alpha	611	669	2.52e-1	SMART
low complexity region	890	910	N/A	INTRINSIC
transmembrane domain	1129	1151	N/A	INTRINSIC
Pfam:Integrin_alpha	1152	1166	9e-7	PFAM

Meta Mutation Damage Score

0.0832

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 96.9%
20x: 92.2%

Validation Efficiency

100% (102/102)

MGI Phenotype

Strain: 2675420;2183401
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of a transmembrane receptor for collagens and related proteins. The encoded protein forms a heterodimer with a beta subunit and mediates the adhesion of platelets and other cell types to the extracellular matrix. Loss of the encoded protein is associated with bleeding disorder platelet-type 9. Antibodies against this protein are found in several immune disorders, including neonatal alloimmune thrombocytopenia. This gene is located adjacent to a related alpha subunit gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for targeted null mutations were viable, fertile, showed no overt anatomical defects, and exhibited no bleeding anomalies. Platelet, primary fibroblast and keratinocytes from homozygous mutant mice show less efficient adhesion to collagens in vitro. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110082I17Rik	A	G	5: 139,364,120	V58A	possibly damaging	Het
4932415M13Rik	A	T	17: 53,724,346		noncoding transcript	Het
A930003A15Rik	T	C	16: 19,883,872		noncoding transcript	Het
Abca8a	A	T	11: 110,040,564	D1253E	possibly damaging	Het
Acsm3	T	C	7: 119,777,100	I350T	possibly damaging	Het
Adcy9	T	C	16: 4,419,271	D92G	possibly damaging	Het
Aldh9a1	G	A	1: 167,350,255	G7D	probably benign	Het
Alg14	A	G	3: 121,298,610	H34R	probably damaging	Het
Ankrd27	A	G	7: 35,608,347	N337S	probably damaging	Het
Apoa2	T	A	1: 171,225,379		probably benign	Het
Asphd2	A	T	5: 112,391,769	L66H	probably damaging	Het
Astl	T	C	2: 127,342,419	F21L	probably benign	Het
Bptf	C	A	11: 107,110,812		probably null	Het
Cacna2d4	C	T	6: 119,307,286	R745W	probably damaging	Het
Cadps2	T	C	6: 23,328,776		probably benign	Het
Camk4	G	T	18: 32,939,454	S20I	unknown	Het
Ccdc36	A	T	9: 108,404,801	C563S	probably benign	Het
Ccdc85a	T	A	11: 28,583,296	I83F	probably damaging	Het
Ccnt2	T	A	1: 127,802,394	M336K	probably benign	Het
Cd209e	G	T	8: 3,853,205	D62E	probably benign	Het
Ces1f	A	T	8: 93,270,024	S214T	probably damaging	Het
Cfap43	C	A	19: 47,815,846	V304L	probably benign	Het
Col26a1	A	G	5: 136,765,300		probably null	Het
Cpa5	T	C	6: 30,623,211	S124P	probably damaging	Het
Crtc1	A	G	8: 70,393,013	V306A	probably benign	Het
D130043K22Rik	G	A	13: 24,863,580		probably benign	Het
D17H6S53E	A	T	17: 35,127,409		probably null	Het
D17Wsu92e	A	T	17: 27,786,138	S148R	probably damaging	Het
Dmxl1	T	C	18: 49,833,148	V20A	probably damaging	Het
Dnah11	G	A	12: 118,196,662	A111V	probably benign	Het
Dyrk2	T	C	10: 118,861,122	H77R	probably benign	Het
E330017A01Rik	G	A	16: 58,635,523	S129L	probably damaging	Het
Epha3	A	G	16: 63,603,519		probably benign	Het
Epn2	T	C	11: 61,519,491	N611S	probably benign	Het
Erich6	A	C	3: 58,618,944		probably benign	Het
Fam217b	T	C	2: 178,420,989	S249P	probably benign	Het
Fezf1	T	C	6: 23,246,999	H278R	probably benign	Het
Fhod3	T	A	18: 25,066,218	Y649N	probably damaging	Het
Gm5155	C	A	7: 17,904,981	A301E	possibly damaging	Het
Gm597	A	G	1: 28,777,821	S377P	possibly damaging	Het
Grap	T	A	11: 61,660,239	D32E	possibly damaging	Het
Hipk1	A	G	3: 103,754,296	S670P	probably damaging	Het
Itgae	A	T	11: 73,129,206	M845L	probably benign	Het
Itgb5	A	G	16: 33,900,583	K339R	probably damaging	Het
Itpka	T	A	2: 119,750,831	N448K	probably damaging	Het
Jak3	A	C	8: 71,683,978	N643T	probably damaging	Het
Kcnd2	T	C	6: 21,726,239		probably benign	Het
Kcnd2	T	A	6: 21,727,329	V627E	probably damaging	Het
Ktn1	A	G	14: 47,701,062		probably null	Het
Lamp1	T	A	8: 13,172,654	F279L	probably damaging	Het
Macf1	A	G	4: 123,494,882		probably null	Het
Mark2	A	G	19: 7,285,824	Y193H	probably damaging	Het
Mcrs1	T	C	15: 99,243,449		probably benign	Het
Mtnr1a	A	T	8: 45,087,937	I312F	probably benign	Het
Myom2	A	T	8: 15,132,924	K1454*	probably null	Het
Nfkbia	C	A	12: 55,490,776	A211S	probably damaging	Het
Olfr504	T	C	7: 108,564,998	T266A	possibly damaging	Het
Olfr629	T	C	7: 103,740,925	H105R	probably damaging	Het
Olfr905	A	T	9: 38,472,785	I13F	probably benign	Het
Otog	C	T	7: 46,269,362	T954I	possibly damaging	Het
Phlpp2	A	G	8: 109,937,106	T926A	probably damaging	Het
Plec	GGCAGCAG	GGCAGCAGCAG	15: 76,181,907		probably benign	Het
Plekha5	T	A	6: 140,589,634		probably benign	Het
Pmch	A	G	10: 88,091,224	I30V	probably benign	Het
Ppat	A	C	5: 76,922,501	Y157D	probably benign	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Rab27b	T	C	18: 69,987,041		probably benign	Het
Rapsn	T	C	2: 91,036,808	Y152H	probably damaging	Het
Rasd1	A	T	11: 59,964,553	F85I	probably damaging	Het
Rbp3	T	G	14: 33,956,638	S848A	possibly damaging	Het
Rgs1	A	T	1: 144,247,933	S85T	probably damaging	Het
Rictor	A	G	15: 6,764,278		probably null	Het
Rims1	T	C	1: 22,427,459		probably null	Het
Shc1	A	G	3: 89,422,969	D70G	probably damaging	Het
Slc22a28	T	C	19: 8,116,833	Y245C	possibly damaging	Het
Slc25a1	T	A	16: 17,927,436	H78L	probably benign	Het
Slc30a7	T	A	3: 115,990,140		probably null	Het
Slc34a2	A	G	5: 53,067,707	T397A	probably benign	Het
Slc51a	T	A	16: 32,475,849	T306S	probably benign	Het
Sorcs3	G	A	19: 48,487,394	V231I	probably benign	Het
Sp100	A	T	1: 85,699,744	I86L	probably damaging	Het
Stard9	T	G	2: 120,696,999	S1246A	possibly damaging	Het
Stxbp5	A	T	10: 9,865,099	S116R	probably damaging	Het
Tas2r105	T	C	6: 131,687,430	I12V	probably benign	Het
Tas2r121	A	G	6: 132,700,362	S216P	probably damaging	Het
Tax1bp1	C	T	6: 52,741,940		probably benign	Het
Tcof1	T	C	18: 60,845,832	D48G	probably damaging	Het
Tex24	A	T	8: 27,344,720	H92L	possibly damaging	Het
Tgm3	C	T	2: 130,026,682		probably benign	Het
Thbs4	T	G	13: 92,758,038	D659A	probably damaging	Het
Tmed11	A	T	5: 108,795,309	M1K	probably null	Het
Tmpo	A	T	10: 91,161,953	C657*	probably null	Het
Unc5a	C	A	13: 55,003,933	N56K	possibly damaging	Het
Urb1	T	C	16: 90,795,448	D308G	possibly damaging	Het
Vav3	A	G	3: 109,647,679	N81S	possibly damaging	Het
Vmn2r108	A	T	17: 20,471,459	D267E	probably benign	Het
Vmn2r17	A	T	5: 109,427,956	H231L	possibly damaging	Het
Wrn	A	G	8: 33,295,006	I446T	possibly damaging	Het
Zfp266	G	A	9: 20,499,799	H361Y	probably damaging	Het

Other mutations in Itga2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00809:Itga2	APN	13	114877625	missense	probably damaging	0.99
IGL01481:Itga2	APN	13	114859632	missense	possibly damaging	0.63
IGL01666:Itga2	APN	13	114837091	critical splice donor site	probably null
IGL01730:Itga2	APN	13	114854411	splice site	probably benign
IGL01965:Itga2	APN	13	114848064	splice site	probably benign
IGL01987:Itga2	APN	13	114847946	nonsense	probably null
IGL02334:Itga2	APN	13	114865309	critical splice donor site	probably null
IGL02381:Itga2	APN	13	114856722	missense	probably damaging	1.00
IGL02562:Itga2	APN	13	114836570	unclassified	probably benign
IGL03191:Itga2	APN	13	114836484	unclassified	probably benign
IGL03209:Itga2	APN	13	114880632	missense	probably damaging	1.00
P0007:Itga2	UTSW	13	114866199	missense	probably damaging	1.00
R0023:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0023:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0025:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0029:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0062:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0062:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0149:Itga2	UTSW	13	114836579	unclassified	probably benign
R0152:Itga2	UTSW	13	114866314	missense	probably benign	0.06
R0496:Itga2	UTSW	13	114853899	missense	probably benign	0.00
R0502:Itga2	UTSW	13	114845856	missense	probably benign	0.15
R0599:Itga2	UTSW	13	114856650	splice site	probably benign
R0688:Itga2	UTSW	13	114839554	missense	probably benign	0.00
R0704:Itga2	UTSW	13	114862375	missense	possibly damaging	0.91
R0760:Itga2	UTSW	13	114859632	missense	possibly damaging	0.63
R0811:Itga2	UTSW	13	114870614	missense	possibly damaging	0.92
R0812:Itga2	UTSW	13	114870614	missense	possibly damaging	0.92
R1196:Itga2	UTSW	13	114866155	critical splice donor site	probably null
R1546:Itga2	UTSW	13	114849420	missense	possibly damaging	0.63
R1639:Itga2	UTSW	13	114857296	missense	probably benign	0.00
R1834:Itga2	UTSW	13	114856726	missense	probably damaging	0.98
R1834:Itga2	UTSW	13	114856727	missense	probably damaging	1.00
R2180:Itga2	UTSW	13	114849381	missense	possibly damaging	0.67
R2190:Itga2	UTSW	13	114870605	missense	probably benign	0.05
R2518:Itga2	UTSW	13	114881042	missense	probably damaging	1.00
R3885:Itga2	UTSW	13	114869299	missense	probably benign	0.35
R3962:Itga2	UTSW	13	114839518	missense	probably damaging	0.99
R4094:Itga2	UTSW	13	114870625	missense	probably benign	0.01
R4193:Itga2	UTSW	13	114886649	nonsense	probably null
R4290:Itga2	UTSW	13	114866173	missense	probably damaging	0.98
R4459:Itga2	UTSW	13	114843483	missense	probably damaging	0.97
R4460:Itga2	UTSW	13	114843483	missense	probably damaging	0.97
R4628:Itga2	UTSW	13	114877693	missense	probably benign	0.03
R4655:Itga2	UTSW	13	114873269	missense	probably benign	0.00
R4716:Itga2	UTSW	13	114857373	missense	probably damaging	0.98
R4896:Itga2	UTSW	13	114853766	nonsense	probably null
R5093:Itga2	UTSW	13	114856181	missense	probably benign	0.00
R5488:Itga2	UTSW	13	114843435	missense	probably damaging	1.00
R5489:Itga2	UTSW	13	114843435	missense	probably damaging	1.00
R5743:Itga2	UTSW	13	114884506	missense	probably damaging	1.00
R5767:Itga2	UTSW	13	114839570	missense	possibly damaging	0.88
R5790:Itga2	UTSW	13	114868206	missense	probably benign	0.02
R5923:Itga2	UTSW	13	114884519	missense	probably benign	0.02
R6163:Itga2	UTSW	13	114866190	missense	probably damaging	1.00
R6227:Itga2	UTSW	13	114839561	missense	probably benign	0.30
R6278:Itga2	UTSW	13	114845888	missense	probably benign	0.05
R6283:Itga2	UTSW	13	114869250	missense	probably damaging	1.00
R6332:Itga2	UTSW	13	114843473	missense	probably benign
R6510:Itga2	UTSW	13	114873280	missense	probably damaging	1.00
R6742:Itga2	UTSW	13	114836525	missense	possibly damaging	0.93
R6869:Itga2	UTSW	13	114875537	splice site	probably null
R7073:Itga2	UTSW	13	114859613	missense	probably damaging	1.00
R7111:Itga2	UTSW	13	114900530	missense	unknown
R7236:Itga2	UTSW	13	114877691	missense	probably benign
R7269:Itga2	UTSW	13	114886689	nonsense	probably null
R7296:Itga2	UTSW	13	114857394	splice site	probably null
R7350:Itga2	UTSW	13	114837202	missense	probably damaging	0.98
R7375:Itga2	UTSW	13	114869217	missense	probably benign	0.06
R7501:Itga2	UTSW	13	114875559	missense	probably damaging	1.00
R7687:Itga2	UTSW	13	114866260	missense	probably damaging	1.00
R7766:Itga2	UTSW	13	114853891	missense	probably benign
R7810:Itga2	UTSW	13	114866179	missense	probably benign	0.15
R8038:Itga2	UTSW	13	114853755	missense	probably damaging	1.00
R8948:Itga2	UTSW	13	114873330	missense	probably damaging	1.00
R9132:Itga2	UTSW	13	114877762	nonsense	probably null
R9153:Itga2	UTSW	13	114865405	missense	probably benign	0.00
R9159:Itga2	UTSW	13	114877762	nonsense	probably null
R9651:Itga2	UTSW	13	114884455	missense	probably benign	0.00
R9652:Itga2	UTSW	13	114884455	missense	probably benign	0.00
R9653:Itga2	UTSW	13	114884455	missense	probably benign	0.00
Z1088:Itga2	UTSW	13	114857332	missense	possibly damaging	0.46
Z1177:Itga2	UTSW	13	114853701	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCAAACCCAGCCAGTTAGCATTTC -3'
(R):5'- CAAGAGCAGTGCCAAGTATCCAAGG -3'

Sequencing Primer
(F):5'- AGCCAGTTAGCATTTCTCATTG -3'
(R):5'- tgttcatctctctctactatgcc -3'

Posted On

2013-10-16