Incidental Mutation 'R0836:Rbp3'
ID 77946
Institutional Source Beutler Lab
Gene Symbol Rbp3
Ensembl Gene ENSMUSG00000041534
Gene Name retinol binding protein 3, interstitial
Synonyms Irbp, Rbp-3
MMRRC Submission 039015-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.147) question?
Stock # R0836 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 33675960-33686173 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 33678595 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 848 (S848A)
Ref Sequence ENSEMBL: ENSMUSP00000040249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035695]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000035695
AA Change: S848A

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: S848A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
TSPc 109 308 5.72e-69 SMART
TSPc 416 616 1.98e-63 SMART
TSPc 720 917 5.34e-69 SMART
TSPc 1019 1216 2.13e-68 SMART
Meta Mutation Damage Score 0.0833 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.2%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik A G 5: 139,349,875 (GRCm39) V58A possibly damaging Het
4932415M13Rik A T 17: 54,031,374 (GRCm39) noncoding transcript Het
A930003A15Rik T C 16: 19,702,622 (GRCm39) noncoding transcript Het
Abca8a A T 11: 109,931,390 (GRCm39) D1253E possibly damaging Het
Acsm3 T C 7: 119,376,323 (GRCm39) I350T possibly damaging Het
Adcy9 T C 16: 4,237,135 (GRCm39) D92G possibly damaging Het
Aldh9a1 G A 1: 167,177,824 (GRCm39) G7D probably benign Het
Alg14 A G 3: 121,092,259 (GRCm39) H34R probably damaging Het
Ankrd27 A G 7: 35,307,772 (GRCm39) N337S probably damaging Het
Apoa2 T A 1: 171,052,948 (GRCm39) probably benign Het
Asphd2 A T 5: 112,539,635 (GRCm39) L66H probably damaging Het
Astl T C 2: 127,184,339 (GRCm39) F21L probably benign Het
Bptf C A 11: 107,001,638 (GRCm39) probably null Het
Cacna2d4 C T 6: 119,284,247 (GRCm39) R745W probably damaging Het
Cadps2 T C 6: 23,328,775 (GRCm39) probably benign Het
Camk4 G T 18: 33,072,507 (GRCm39) S20I unknown Het
Ccdc85a T A 11: 28,533,296 (GRCm39) I83F probably damaging Het
Ccnt2 T A 1: 127,730,131 (GRCm39) M336K probably benign Het
Cd209e G T 8: 3,903,205 (GRCm39) D62E probably benign Het
Ceacam23 C A 7: 17,638,906 (GRCm39) A301E possibly damaging Het
Ces1f A T 8: 93,996,652 (GRCm39) S214T probably damaging Het
Cfap43 C A 19: 47,804,285 (GRCm39) V304L probably benign Het
Col26a1 A G 5: 136,794,154 (GRCm39) probably null Het
Cpa5 T C 6: 30,623,210 (GRCm39) S124P probably damaging Het
Crtc1 A G 8: 70,845,663 (GRCm39) V306A probably benign Het
D130043K22Rik G A 13: 25,047,563 (GRCm39) probably benign Het
D17H6S53E A T 17: 35,346,385 (GRCm39) probably null Het
Dmxl1 T C 18: 49,966,215 (GRCm39) V20A probably damaging Het
Dnah11 G A 12: 118,160,397 (GRCm39) A111V probably benign Het
Dyrk2 T C 10: 118,697,027 (GRCm39) H77R probably benign Het
Epha3 A G 16: 63,423,882 (GRCm39) probably benign Het
Epn2 T C 11: 61,410,317 (GRCm39) N611S probably benign Het
Erich6 A C 3: 58,526,365 (GRCm39) probably benign Het
Fam217b T C 2: 178,062,782 (GRCm39) S249P probably benign Het
Fezf1 T C 6: 23,246,998 (GRCm39) H278R probably benign Het
Fhod3 T A 18: 25,199,275 (GRCm39) Y649N probably damaging Het
Ftdc2 G A 16: 58,455,886 (GRCm39) S129L probably damaging Het
Grap T A 11: 61,551,065 (GRCm39) D32E possibly damaging Het
Hipk1 A G 3: 103,661,612 (GRCm39) S670P probably damaging Het
Iho1 A T 9: 108,282,000 (GRCm39) C563S probably benign Het
Ilrun A T 17: 28,005,112 (GRCm39) S148R probably damaging Het
Itga2 A G 13: 114,993,215 (GRCm39) V800A probably damaging Het
Itgae A T 11: 73,020,032 (GRCm39) M845L probably benign Het
Itgb5 A G 16: 33,720,953 (GRCm39) K339R probably damaging Het
Itpka T A 2: 119,581,312 (GRCm39) N448K probably damaging Het
Jak3 A C 8: 72,136,622 (GRCm39) N643T probably damaging Het
Kcnd2 T A 6: 21,727,328 (GRCm39) V627E probably damaging Het
Kcnd2 T C 6: 21,726,238 (GRCm39) probably benign Het
Ktn1 A G 14: 47,938,519 (GRCm39) probably null Het
Lamp1 T A 8: 13,222,654 (GRCm39) F279L probably damaging Het
Macf1 A G 4: 123,388,675 (GRCm39) probably null Het
Mark2 A G 19: 7,263,189 (GRCm39) Y193H probably damaging Het
Mcrs1 T C 15: 99,141,330 (GRCm39) probably benign Het
Mtnr1a A T 8: 45,540,974 (GRCm39) I312F probably benign Het
Myom2 A T 8: 15,182,924 (GRCm39) K1454* probably null Het
Nfkbia C A 12: 55,537,561 (GRCm39) A211S probably damaging Het
Or52ae9 T C 7: 103,390,132 (GRCm39) H105R probably damaging Het
Or56b1b T C 7: 108,164,205 (GRCm39) T266A possibly damaging Het
Or8b1c A T 9: 38,384,081 (GRCm39) I13F probably benign Het
Otog C T 7: 45,918,786 (GRCm39) T954I possibly damaging Het
Phlpp2 A G 8: 110,663,738 (GRCm39) T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,066,107 (GRCm39) probably benign Het
Plekha5 T A 6: 140,535,360 (GRCm39) probably benign Het
Pmch A G 10: 87,927,086 (GRCm39) I30V probably benign Het
Ppat A C 5: 77,070,348 (GRCm39) Y157D probably benign Het
Ppp1r16a C T 15: 76,577,869 (GRCm39) Q328* probably null Het
Rab27b T C 18: 70,120,112 (GRCm39) probably benign Het
Rapsn T C 2: 90,867,153 (GRCm39) Y152H probably damaging Het
Rasd1 A T 11: 59,855,379 (GRCm39) F85I probably damaging Het
Rgs1 A T 1: 144,123,671 (GRCm39) S85T probably damaging Het
Rictor A G 15: 6,793,759 (GRCm39) probably null Het
Rims1 T C 1: 22,497,709 (GRCm39) probably null Het
Shc1 A G 3: 89,330,276 (GRCm39) D70G probably damaging Het
Slc22a28 T C 19: 8,094,197 (GRCm39) Y245C possibly damaging Het
Slc25a1 T A 16: 17,745,300 (GRCm39) H78L probably benign Het
Slc30a7 T A 3: 115,783,789 (GRCm39) probably null Het
Slc34a2 A G 5: 53,225,049 (GRCm39) T397A probably benign Het
Slc51a T A 16: 32,294,667 (GRCm39) T306S probably benign Het
Sorcs3 G A 19: 48,475,833 (GRCm39) V231I probably benign Het
Sp100 A T 1: 85,627,465 (GRCm39) I86L probably damaging Het
Spata31e5 A G 1: 28,816,902 (GRCm39) S377P possibly damaging Het
Stard9 T G 2: 120,527,480 (GRCm39) S1246A possibly damaging Het
Stxbp5 A T 10: 9,740,843 (GRCm39) S116R probably damaging Het
Tas2r105 T C 6: 131,664,393 (GRCm39) I12V probably benign Het
Tas2r121 A G 6: 132,677,325 (GRCm39) S216P probably damaging Het
Tax1bp1 C T 6: 52,718,925 (GRCm39) probably benign Het
Tcof1 T C 18: 60,978,904 (GRCm39) D48G probably damaging Het
Tex24 A T 8: 27,834,748 (GRCm39) H92L possibly damaging Het
Tgm3 C T 2: 129,868,602 (GRCm39) probably benign Het
Thbs4 T G 13: 92,894,546 (GRCm39) D659A probably damaging Het
Tmed11 A T 5: 108,943,175 (GRCm39) M1K probably null Het
Tmpo A T 10: 90,997,815 (GRCm39) C657* probably null Het
Unc5a C A 13: 55,151,746 (GRCm39) N56K possibly damaging Het
Urb1 T C 16: 90,592,336 (GRCm39) D308G possibly damaging Het
Vav3 A G 3: 109,554,995 (GRCm39) N81S possibly damaging Het
Vmn2r108 A T 17: 20,691,721 (GRCm39) D267E probably benign Het
Vmn2r17 A T 5: 109,575,822 (GRCm39) H231L possibly damaging Het
Wrn A G 8: 33,785,034 (GRCm39) I446T possibly damaging Het
Zfp266 G A 9: 20,411,095 (GRCm39) H361Y probably damaging Het
Other mutations in Rbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Rbp3 APN 14 33,676,145 (GRCm39) missense possibly damaging 0.82
IGL01643:Rbp3 APN 14 33,678,793 (GRCm39) missense probably benign 0.18
IGL01665:Rbp3 APN 14 33,678,088 (GRCm39) missense probably benign 0.02
IGL01809:Rbp3 APN 14 33,677,257 (GRCm39) missense probably damaging 1.00
IGL01975:Rbp3 APN 14 33,680,602 (GRCm39) missense probably damaging 1.00
IGL02349:Rbp3 APN 14 33,677,676 (GRCm39) missense probably damaging 0.97
IGL02447:Rbp3 APN 14 33,676,460 (GRCm39) missense probably damaging 1.00
IGL03192:Rbp3 APN 14 33,680,540 (GRCm39) missense possibly damaging 0.52
IGL03302:Rbp3 APN 14 33,676,616 (GRCm39) missense probably damaging 0.97
Behagt UTSW 14 33,676,411 (GRCm39) missense probably benign 0.00
jagt UTSW 14 33,678,439 (GRCm39) missense probably damaging 0.97
muntre UTSW 14 33,678,313 (GRCm39) missense possibly damaging 0.95
Rotwild UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
P4717OSA:Rbp3 UTSW 14 33,677,456 (GRCm39) missense probably damaging 0.96
R0234:Rbp3 UTSW 14 33,677,858 (GRCm39) missense probably damaging 0.98
R0234:Rbp3 UTSW 14 33,677,858 (GRCm39) missense probably damaging 0.98
R0432:Rbp3 UTSW 14 33,676,730 (GRCm39) missense probably damaging 1.00
R0469:Rbp3 UTSW 14 33,684,376 (GRCm39) missense possibly damaging 0.95
R0652:Rbp3 UTSW 14 33,680,605 (GRCm39) missense possibly damaging 0.89
R0739:Rbp3 UTSW 14 33,680,604 (GRCm39) missense probably benign 0.28
R0747:Rbp3 UTSW 14 33,678,235 (GRCm39) missense possibly damaging 0.51
R1102:Rbp3 UTSW 14 33,678,313 (GRCm39) missense possibly damaging 0.95
R1583:Rbp3 UTSW 14 33,676,481 (GRCm39) missense possibly damaging 0.45
R1589:Rbp3 UTSW 14 33,677,749 (GRCm39) missense probably damaging 0.99
R1595:Rbp3 UTSW 14 33,678,155 (GRCm39) missense possibly damaging 0.93
R1720:Rbp3 UTSW 14 33,678,866 (GRCm39) missense probably benign 0.38
R1830:Rbp3 UTSW 14 33,676,601 (GRCm39) missense probably benign 0.31
R1982:Rbp3 UTSW 14 33,676,502 (GRCm39) missense probably damaging 0.99
R1985:Rbp3 UTSW 14 33,678,418 (GRCm39) missense probably benign 0.00
R1985:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2007:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2027:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2100:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2101:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2113:Rbp3 UTSW 14 33,678,014 (GRCm39) missense probably benign 0.00
R2138:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2183:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2248:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2277:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2306:Rbp3 UTSW 14 33,684,520 (GRCm39) missense probably damaging 1.00
R2504:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2696:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2697:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2698:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2920:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2940:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2971:Rbp3 UTSW 14 33,676,411 (GRCm39) missense probably benign 0.00
R3111:Rbp3 UTSW 14 33,676,069 (GRCm39) missense probably benign 0.01
R3155:Rbp3 UTSW 14 33,679,071 (GRCm39) missense probably damaging 0.98
R3156:Rbp3 UTSW 14 33,679,071 (GRCm39) missense probably damaging 0.98
R3751:Rbp3 UTSW 14 33,677,969 (GRCm39) missense probably damaging 0.98
R3752:Rbp3 UTSW 14 33,677,969 (GRCm39) missense probably damaging 0.98
R3851:Rbp3 UTSW 14 33,677,464 (GRCm39) missense probably damaging 0.98
R4016:Rbp3 UTSW 14 33,677,347 (GRCm39) missense possibly damaging 0.82
R4276:Rbp3 UTSW 14 33,680,607 (GRCm39) missense probably benign 0.24
R4277:Rbp3 UTSW 14 33,680,607 (GRCm39) missense probably benign 0.24
R4278:Rbp3 UTSW 14 33,680,607 (GRCm39) missense probably benign 0.24
R4382:Rbp3 UTSW 14 33,677,253 (GRCm39) missense probably benign 0.12
R4383:Rbp3 UTSW 14 33,677,253 (GRCm39) missense probably benign 0.12
R4385:Rbp3 UTSW 14 33,677,253 (GRCm39) missense probably benign 0.12
R4625:Rbp3 UTSW 14 33,678,056 (GRCm39) missense probably benign
R4712:Rbp3 UTSW 14 33,682,615 (GRCm39) missense probably damaging 0.97
R4812:Rbp3 UTSW 14 33,676,731 (GRCm39) missense probably damaging 0.99
R4918:Rbp3 UTSW 14 33,677,368 (GRCm39) missense probably damaging 1.00
R4971:Rbp3 UTSW 14 33,676,427 (GRCm39) missense probably damaging 0.98
R5262:Rbp3 UTSW 14 33,676,807 (GRCm39) missense probably damaging 1.00
R5387:Rbp3 UTSW 14 33,678,370 (GRCm39) missense possibly damaging 0.95
R5468:Rbp3 UTSW 14 33,678,584 (GRCm39) missense possibly damaging 0.93
R5837:Rbp3 UTSW 14 33,676,230 (GRCm39) missense probably benign 0.00
R5994:Rbp3 UTSW 14 33,676,857 (GRCm39) missense probably damaging 1.00
R6010:Rbp3 UTSW 14 33,676,604 (GRCm39) missense probably damaging 1.00
R6041:Rbp3 UTSW 14 33,678,439 (GRCm39) missense probably damaging 0.97
R6266:Rbp3 UTSW 14 33,676,418 (GRCm39) missense probably benign
R6357:Rbp3 UTSW 14 33,678,991 (GRCm39) missense probably damaging 0.99
R6457:Rbp3 UTSW 14 33,677,224 (GRCm39) nonsense probably null
R6777:Rbp3 UTSW 14 33,676,230 (GRCm39) missense probably benign 0.00
R7158:Rbp3 UTSW 14 33,677,513 (GRCm39) missense probably benign 0.00
R7183:Rbp3 UTSW 14 33,677,161 (GRCm39) missense probably benign 0.02
R7256:Rbp3 UTSW 14 33,684,540 (GRCm39) missense possibly damaging 0.93
R7654:Rbp3 UTSW 14 33,677,797 (GRCm39) missense probably benign
R7756:Rbp3 UTSW 14 33,676,732 (GRCm39) missense probably benign 0.15
R7758:Rbp3 UTSW 14 33,676,732 (GRCm39) missense probably benign 0.15
R7784:Rbp3 UTSW 14 33,676,115 (GRCm39) missense probably benign 0.41
R7845:Rbp3 UTSW 14 33,678,421 (GRCm39) missense probably benign 0.24
R8176:Rbp3 UTSW 14 33,677,605 (GRCm39) missense possibly damaging 0.67
R8281:Rbp3 UTSW 14 33,678,320 (GRCm39) missense probably benign 0.00
R8393:Rbp3 UTSW 14 33,678,156 (GRCm39) missense possibly damaging 0.93
R8552:Rbp3 UTSW 14 33,677,621 (GRCm39) missense probably benign 0.01
R8717:Rbp3 UTSW 14 33,678,395 (GRCm39) missense probably damaging 0.99
R8730:Rbp3 UTSW 14 33,677,795 (GRCm39) missense probably benign
R8773:Rbp3 UTSW 14 33,684,492 (GRCm39) missense possibly damaging 0.71
R8836:Rbp3 UTSW 14 33,680,588 (GRCm39) missense possibly damaging 0.95
R8843:Rbp3 UTSW 14 33,676,522 (GRCm39) missense probably benign
R8880:Rbp3 UTSW 14 33,678,796 (GRCm39) missense probably benign 0.16
R8941:Rbp3 UTSW 14 33,678,486 (GRCm39) missense possibly damaging 0.92
R8971:Rbp3 UTSW 14 33,677,792 (GRCm39) missense probably damaging 1.00
R8998:Rbp3 UTSW 14 33,684,360 (GRCm39) nonsense probably null
R8999:Rbp3 UTSW 14 33,684,360 (GRCm39) nonsense probably null
R9436:Rbp3 UTSW 14 33,677,234 (GRCm39) missense possibly damaging 0.94
R9525:Rbp3 UTSW 14 33,676,402 (GRCm39) missense probably benign 0.00
R9563:Rbp3 UTSW 14 33,677,477 (GRCm39) missense probably damaging 1.00
R9564:Rbp3 UTSW 14 33,677,477 (GRCm39) missense probably damaging 1.00
R9723:Rbp3 UTSW 14 33,677,474 (GRCm39) missense possibly damaging 0.92
Z1177:Rbp3 UTSW 14 33,676,495 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTGTTGACCTGCGCTACAACCC -3'
(R):5'- ATGTCAGGTTCCACACCAGCCAAG -3'

Sequencing Primer
(F):5'- GGCAGCTACTCTTCTGCCG -3'
(R):5'- ACCAGCCAAGTCCCAGG -3'
Posted On 2013-10-16