Incidental Mutation 'R0836:Rictor'
ID77948
Institutional Source Beutler Lab
Gene Symbol Rictor
Ensembl Gene ENSMUSG00000050310
Gene NameRPTOR independent companion of MTOR, complex 2
SynonymsD530039E11Rik, 4921505C17Rik, 6030405M08Rik
MMRRC Submission 039015-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0836 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location6708379-6800401 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 6764278 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061656]
Predicted Effect probably null
Transcript: ENSMUST00000061656
SMART Domains Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310

DomainStartEndE-ValueType
RICTOR_N 57 439 4.02e-185 SMART
RICTOR_M 523 742 5.66e-98 SMART
RasGEF_N_2 743 857 1.26e-54 SMART
RICTOR_V 920 992 1.44e-40 SMART
low complexity region 1019 1043 N/A INTRINSIC
RICTOR_phospho 1084 1189 4.06e-58 SMART
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1255 1266 N/A INTRINSIC
low complexity region 1273 1287 N/A INTRINSIC
low complexity region 1404 1414 N/A INTRINSIC
low complexity region 1464 1474 N/A INTRINSIC
low complexity region 1616 1628 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228918
Meta Mutation Damage Score 0.47 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.2%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik A G 5: 139,364,120 V58A possibly damaging Het
4932415M13Rik A T 17: 53,724,346 noncoding transcript Het
A930003A15Rik T C 16: 19,883,872 noncoding transcript Het
Abca8a A T 11: 110,040,564 D1253E possibly damaging Het
Acsm3 T C 7: 119,777,100 I350T possibly damaging Het
Adcy9 T C 16: 4,419,271 D92G possibly damaging Het
Aldh9a1 G A 1: 167,350,255 G7D probably benign Het
Alg14 A G 3: 121,298,610 H34R probably damaging Het
Ankrd27 A G 7: 35,608,347 N337S probably damaging Het
Apoa2 T A 1: 171,225,379 probably benign Het
Asphd2 A T 5: 112,391,769 L66H probably damaging Het
Astl T C 2: 127,342,419 F21L probably benign Het
Bptf C A 11: 107,110,812 probably null Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cadps2 T C 6: 23,328,776 probably benign Het
Camk4 G T 18: 32,939,454 S20I unknown Het
Ccdc36 A T 9: 108,404,801 C563S probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd209e G T 8: 3,853,205 D62E probably benign Het
Ces1f A T 8: 93,270,024 S214T probably damaging Het
Cfap43 C A 19: 47,815,846 V304L probably benign Het
Col26a1 A G 5: 136,765,300 probably null Het
Cpa5 T C 6: 30,623,211 S124P probably damaging Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
D17H6S53E A T 17: 35,127,409 probably null Het
D17Wsu92e A T 17: 27,786,138 S148R probably damaging Het
Dmxl1 T C 18: 49,833,148 V20A probably damaging Het
Dnah11 G A 12: 118,196,662 A111V probably benign Het
Dyrk2 T C 10: 118,861,122 H77R probably benign Het
E330017A01Rik G A 16: 58,635,523 S129L probably damaging Het
Epha3 A G 16: 63,603,519 probably benign Het
Epn2 T C 11: 61,519,491 N611S probably benign Het
Erich6 A C 3: 58,618,944 probably benign Het
Fam217b T C 2: 178,420,989 S249P probably benign Het
Fezf1 T C 6: 23,246,999 H278R probably benign Het
Fhod3 T A 18: 25,066,218 Y649N probably damaging Het
Gm5155 C A 7: 17,904,981 A301E possibly damaging Het
Gm597 A G 1: 28,777,821 S377P possibly damaging Het
Grap T A 11: 61,660,239 D32E possibly damaging Het
Hipk1 A G 3: 103,754,296 S670P probably damaging Het
Itga2 A G 13: 114,856,679 V800A probably damaging Het
Itgae A T 11: 73,129,206 M845L probably benign Het
Itgb5 A G 16: 33,900,583 K339R probably damaging Het
Itpka T A 2: 119,750,831 N448K probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Kcnd2 T C 6: 21,726,239 probably benign Het
Kcnd2 T A 6: 21,727,329 V627E probably damaging Het
Ktn1 A G 14: 47,701,062 probably null Het
Lamp1 T A 8: 13,172,654 F279L probably damaging Het
Macf1 A G 4: 123,494,882 probably null Het
Mark2 A G 19: 7,285,824 Y193H probably damaging Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Myom2 A T 8: 15,132,924 K1454* probably null Het
Nfkbia C A 12: 55,490,776 A211S probably damaging Het
Olfr504 T C 7: 108,564,998 T266A possibly damaging Het
Olfr629 T C 7: 103,740,925 H105R probably damaging Het
Olfr905 A T 9: 38,472,785 I13F probably benign Het
Otog C T 7: 46,269,362 T954I possibly damaging Het
Phlpp2 A G 8: 109,937,106 T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,181,907 probably benign Het
Plekha5 T A 6: 140,589,634 probably benign Het
Pmch A G 10: 88,091,224 I30V probably benign Het
Ppat A C 5: 76,922,501 Y157D probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rasd1 A T 11: 59,964,553 F85I probably damaging Het
Rbp3 T G 14: 33,956,638 S848A possibly damaging Het
Rgs1 A T 1: 144,247,933 S85T probably damaging Het
Rims1 T C 1: 22,427,459 probably null Het
Shc1 A G 3: 89,422,969 D70G probably damaging Het
Slc22a28 T C 19: 8,116,833 Y245C possibly damaging Het
Slc25a1 T A 16: 17,927,436 H78L probably benign Het
Slc30a7 T A 3: 115,990,140 probably null Het
Slc34a2 A G 5: 53,067,707 T397A probably benign Het
Slc51a T A 16: 32,475,849 T306S probably benign Het
Sorcs3 G A 19: 48,487,394 V231I probably benign Het
Sp100 A T 1: 85,699,744 I86L probably damaging Het
Stard9 T G 2: 120,696,999 S1246A possibly damaging Het
Stxbp5 A T 10: 9,865,099 S116R probably damaging Het
Tas2r105 T C 6: 131,687,430 I12V probably benign Het
Tas2r121 A G 6: 132,700,362 S216P probably damaging Het
Tax1bp1 C T 6: 52,741,940 probably benign Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tex24 A T 8: 27,344,720 H92L possibly damaging Het
Tgm3 C T 2: 130,026,682 probably benign Het
Thbs4 T G 13: 92,758,038 D659A probably damaging Het
Tmed11 A T 5: 108,795,309 M1K probably null Het
Tmpo A T 10: 91,161,953 C657* probably null Het
Unc5a C A 13: 55,003,933 N56K possibly damaging Het
Urb1 T C 16: 90,795,448 D308G possibly damaging Het
Vav3 A G 3: 109,647,679 N81S possibly damaging Het
Vmn2r108 A T 17: 20,471,459 D267E probably benign Het
Vmn2r17 A T 5: 109,427,956 H231L possibly damaging Het
Wrn A G 8: 33,295,006 I446T possibly damaging Het
Zfp266 G A 9: 20,499,799 H361Y probably damaging Het
Other mutations in Rictor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rictor APN 15 6786590 missense probably damaging 0.99
IGL00785:Rictor APN 15 6776950 missense probably damaging 1.00
IGL00801:Rictor APN 15 6794534 missense probably damaging 1.00
IGL01072:Rictor APN 15 6789562 missense probably damaging 0.98
IGL01139:Rictor APN 15 6778268 missense probably damaging 1.00
IGL01303:Rictor APN 15 6708638 missense probably benign 0.10
IGL01307:Rictor APN 15 6774604 splice site probably null
IGL01767:Rictor APN 15 6777384 missense probably damaging 1.00
IGL01774:Rictor APN 15 6769777 missense probably damaging 1.00
IGL01800:Rictor APN 15 6774701 missense probably damaging 0.99
IGL02192:Rictor APN 15 6786414 missense probably benign 0.00
IGL02503:Rictor APN 15 6786443 missense probably benign 0.06
IGL02652:Rictor APN 15 6776187 critical splice donor site probably null
IGL02656:Rictor APN 15 6776920 missense probably damaging 0.98
IGL02752:Rictor APN 15 6787371 missense probably benign 0.02
IGL03000:Rictor APN 15 6769240 splice site probably benign
IGL03118:Rictor APN 15 6759518 missense possibly damaging 0.93
IGL03182:Rictor APN 15 6789598 missense probably benign 0.08
R0149:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0288:Rictor UTSW 15 6786540 missense probably benign 0.08
R0304:Rictor UTSW 15 6786371 splice site probably null
R0336:Rictor UTSW 15 6776753 critical splice acceptor site probably null
R0361:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0423:Rictor UTSW 15 6773900 missense possibly damaging 0.77
R0453:Rictor UTSW 15 6708642 missense probably benign 0.01
R0515:Rictor UTSW 15 6769301 missense probably damaging 1.00
R0630:Rictor UTSW 15 6794492 missense probably damaging 1.00
R0730:Rictor UTSW 15 6773986 splice site probably benign
R0744:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0881:Rictor UTSW 15 6791670 missense probably benign
R1114:Rictor UTSW 15 6794005 nonsense probably null
R1367:Rictor UTSW 15 6790638 splice site probably benign
R1655:Rictor UTSW 15 6772212 missense probably benign 0.00
R1678:Rictor UTSW 15 6756471 missense probably benign 0.07
R1679:Rictor UTSW 15 6768090 missense possibly damaging 0.92
R1754:Rictor UTSW 15 6735368 missense probably damaging 1.00
R1757:Rictor UTSW 15 6773862 missense possibly damaging 0.95
R1762:Rictor UTSW 15 6756573 missense probably benign 0.00
R1914:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1915:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1994:Rictor UTSW 15 6776156 missense probably benign 0.18
R2145:Rictor UTSW 15 6765107 missense probably damaging 1.00
R2182:Rictor UTSW 15 6772204 missense probably damaging 0.96
R2191:Rictor UTSW 15 6759614 missense probably benign 0.04
R2357:Rictor UTSW 15 6783562 missense probably damaging 0.99
R2914:Rictor UTSW 15 6769995 critical splice donor site probably null
R3082:Rictor UTSW 15 6774857 missense probably benign 0.15
R3885:Rictor UTSW 15 6759610 missense probably damaging 1.00
R3900:Rictor UTSW 15 6789473 missense probably benign 0.01
R4376:Rictor UTSW 15 6786967 missense probably benign 0.00
R4611:Rictor UTSW 15 6787144 missense possibly damaging 0.75
R4644:Rictor UTSW 15 6777935 nonsense probably null
R4718:Rictor UTSW 15 6783160 missense possibly damaging 0.81
R4822:Rictor UTSW 15 6791680 missense probably benign 0.01
R4980:Rictor UTSW 15 6781660 missense probably damaging 1.00
R5034:Rictor UTSW 15 6768095 missense probably damaging 0.98
R5179:Rictor UTSW 15 6795940 missense probably damaging 1.00
R5386:Rictor UTSW 15 6789504 missense probably benign 0.37
R5532:Rictor UTSW 15 6789565 missense probably damaging 1.00
R5549:Rictor UTSW 15 6786910 missense probably damaging 1.00
R5715:Rictor UTSW 15 6750716 nonsense probably null
R5733:Rictor UTSW 15 6783104 missense probably benign
R5822:Rictor UTSW 15 6794006 missense probably benign 0.00
R5848:Rictor UTSW 15 6794006 missense probably benign 0.00
R5849:Rictor UTSW 15 6794006 missense probably benign 0.00
R5850:Rictor UTSW 15 6794006 missense probably benign 0.00
R5854:Rictor UTSW 15 6794006 missense probably benign 0.00
R5855:Rictor UTSW 15 6794006 missense probably benign 0.00
R5856:Rictor UTSW 15 6794006 missense probably benign 0.00
R5936:Rictor UTSW 15 6784161 missense probably damaging 0.99
R6155:Rictor UTSW 15 6793977 missense probably benign 0.44
R6394:Rictor UTSW 15 6769309 missense possibly damaging 0.59
R6549:Rictor UTSW 15 6796175 missense probably damaging 1.00
R6611:Rictor UTSW 15 6750659 missense probably damaging 1.00
R6657:Rictor UTSW 15 6759496 missense possibly damaging 0.94
R6705:Rictor UTSW 15 6794012 missense probably benign 0.00
R6819:Rictor UTSW 15 6796036 critical splice donor site probably null
R6985:Rictor UTSW 15 6772154 missense probably benign 0.27
R6989:Rictor UTSW 15 6772154 missense probably benign 0.27
R7016:Rictor UTSW 15 6774880 critical splice donor site probably null
R7030:Rictor UTSW 15 6708453 critical splice donor site probably null
R7066:Rictor UTSW 15 6772154 missense probably benign 0.27
R7067:Rictor UTSW 15 6772154 missense probably benign 0.27
R7216:Rictor UTSW 15 6769301 missense probably damaging 1.00
R7396:Rictor UTSW 15 6786981 missense not run
R7449:Rictor UTSW 15 6772154 missense probably benign 0.27
R7450:Rictor UTSW 15 6772154 missense probably benign 0.27
R7452:Rictor UTSW 15 6772154 missense probably benign 0.27
X0020:Rictor UTSW 15 6756482 missense probably benign 0.32
X0060:Rictor UTSW 15 6786552 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCCAGAAGCGCCTTTATGCCC -3'
(R):5'- TGCTATGTACAACTGAGCCACGAAC -3'

Sequencing Primer
(F):5'- GCGCCTTTATGCCCATGTC -3'
(R):5'- CAAGGCCATCTCCTCCCG -3'
Posted On2013-10-16