Mutagenetix > Incidental Mutation

Incidental Mutation 'R0836:Rictor'

77948

Institutional Source

Beutler Lab

Gene Symbol

Rictor

Ensembl Gene

ENSMUSG00000050310

Gene Name

RPTOR independent companion of MTOR, complex 2

Synonyms

D530039E11Rik, 4921505C17Rik, 6030405M08Rik

MMRRC Submission

039015-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0836 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

6708379-6800401 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 6764278 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000051809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061656]

AlphaFold

Q6QI06

Predicted Effect

probably null
Transcript: ENSMUST00000061656

SMART Domains

Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310

Domain	Start	End	E-Value	Type
RICTOR_N	57	439	4.02e-185	SMART
RICTOR_M	523	742	5.66e-98	SMART
RasGEF_N_2	743	857	1.26e-54	SMART
RICTOR_V	920	992	1.44e-40	SMART
low complexity region	1019	1043	N/A	INTRINSIC
RICTOR_phospho	1084	1189	4.06e-58	SMART
low complexity region	1221	1239	N/A	INTRINSIC
low complexity region	1255	1266	N/A	INTRINSIC
low complexity region	1273	1287	N/A	INTRINSIC
low complexity region	1404	1414	N/A	INTRINSIC
low complexity region	1464	1474	N/A	INTRINSIC
low complexity region	1616	1628	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226181

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228266

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228918

Meta Mutation Damage Score

0.9484

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 96.9%
20x: 92.2%

Validation Efficiency

100% (102/102)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110082I17Rik	A	G	5: 139,364,120	V58A	possibly damaging	Het
4932415M13Rik	A	T	17: 53,724,346		noncoding transcript	Het
A930003A15Rik	T	C	16: 19,883,872		noncoding transcript	Het
Abca8a	A	T	11: 110,040,564	D1253E	possibly damaging	Het
Acsm3	T	C	7: 119,777,100	I350T	possibly damaging	Het
Adcy9	T	C	16: 4,419,271	D92G	possibly damaging	Het
Aldh9a1	G	A	1: 167,350,255	G7D	probably benign	Het
Alg14	A	G	3: 121,298,610	H34R	probably damaging	Het
Ankrd27	A	G	7: 35,608,347	N337S	probably damaging	Het
Apoa2	T	A	1: 171,225,379		probably benign	Het
Asphd2	A	T	5: 112,391,769	L66H	probably damaging	Het
Astl	T	C	2: 127,342,419	F21L	probably benign	Het
Bptf	C	A	11: 107,110,812		probably null	Het
Cacna2d4	C	T	6: 119,307,286	R745W	probably damaging	Het
Cadps2	T	C	6: 23,328,776		probably benign	Het
Camk4	G	T	18: 32,939,454	S20I	unknown	Het
Ccdc36	A	T	9: 108,404,801	C563S	probably benign	Het
Ccdc85a	T	A	11: 28,583,296	I83F	probably damaging	Het
Ccnt2	T	A	1: 127,802,394	M336K	probably benign	Het
Cd209e	G	T	8: 3,853,205	D62E	probably benign	Het
Ces1f	A	T	8: 93,270,024	S214T	probably damaging	Het
Cfap43	C	A	19: 47,815,846	V304L	probably benign	Het
Col26a1	A	G	5: 136,765,300		probably null	Het
Cpa5	T	C	6: 30,623,211	S124P	probably damaging	Het
Crtc1	A	G	8: 70,393,013	V306A	probably benign	Het
D130043K22Rik	G	A	13: 24,863,580		probably benign	Het
D17H6S53E	A	T	17: 35,127,409		probably null	Het
D17Wsu92e	A	T	17: 27,786,138	S148R	probably damaging	Het
Dmxl1	T	C	18: 49,833,148	V20A	probably damaging	Het
Dnah11	G	A	12: 118,196,662	A111V	probably benign	Het
Dyrk2	T	C	10: 118,861,122	H77R	probably benign	Het
E330017A01Rik	G	A	16: 58,635,523	S129L	probably damaging	Het
Epha3	A	G	16: 63,603,519		probably benign	Het
Epn2	T	C	11: 61,519,491	N611S	probably benign	Het
Erich6	A	C	3: 58,618,944		probably benign	Het
Fam217b	T	C	2: 178,420,989	S249P	probably benign	Het
Fezf1	T	C	6: 23,246,999	H278R	probably benign	Het
Fhod3	T	A	18: 25,066,218	Y649N	probably damaging	Het
Gm5155	C	A	7: 17,904,981	A301E	possibly damaging	Het
Gm597	A	G	1: 28,777,821	S377P	possibly damaging	Het
Grap	T	A	11: 61,660,239	D32E	possibly damaging	Het
Hipk1	A	G	3: 103,754,296	S670P	probably damaging	Het
Itga2	A	G	13: 114,856,679	V800A	probably damaging	Het
Itgae	A	T	11: 73,129,206	M845L	probably benign	Het
Itgb5	A	G	16: 33,900,583	K339R	probably damaging	Het
Itpka	T	A	2: 119,750,831	N448K	probably damaging	Het
Jak3	A	C	8: 71,683,978	N643T	probably damaging	Het
Kcnd2	T	C	6: 21,726,239		probably benign	Het
Kcnd2	T	A	6: 21,727,329	V627E	probably damaging	Het
Ktn1	A	G	14: 47,701,062		probably null	Het
Lamp1	T	A	8: 13,172,654	F279L	probably damaging	Het
Macf1	A	G	4: 123,494,882		probably null	Het
Mark2	A	G	19: 7,285,824	Y193H	probably damaging	Het
Mcrs1	T	C	15: 99,243,449		probably benign	Het
Mtnr1a	A	T	8: 45,087,937	I312F	probably benign	Het
Myom2	A	T	8: 15,132,924	K1454*	probably null	Het
Nfkbia	C	A	12: 55,490,776	A211S	probably damaging	Het
Olfr504	T	C	7: 108,564,998	T266A	possibly damaging	Het
Olfr629	T	C	7: 103,740,925	H105R	probably damaging	Het
Olfr905	A	T	9: 38,472,785	I13F	probably benign	Het
Otog	C	T	7: 46,269,362	T954I	possibly damaging	Het
Phlpp2	A	G	8: 109,937,106	T926A	probably damaging	Het
Plec	GGCAGCAG	GGCAGCAGCAG	15: 76,181,907		probably benign	Het
Plekha5	T	A	6: 140,589,634		probably benign	Het
Pmch	A	G	10: 88,091,224	I30V	probably benign	Het
Ppat	A	C	5: 76,922,501	Y157D	probably benign	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Rab27b	T	C	18: 69,987,041		probably benign	Het
Rapsn	T	C	2: 91,036,808	Y152H	probably damaging	Het
Rasd1	A	T	11: 59,964,553	F85I	probably damaging	Het
Rbp3	T	G	14: 33,956,638	S848A	possibly damaging	Het
Rgs1	A	T	1: 144,247,933	S85T	probably damaging	Het
Rims1	T	C	1: 22,427,459		probably null	Het
Shc1	A	G	3: 89,422,969	D70G	probably damaging	Het
Slc22a28	T	C	19: 8,116,833	Y245C	possibly damaging	Het
Slc25a1	T	A	16: 17,927,436	H78L	probably benign	Het
Slc30a7	T	A	3: 115,990,140		probably null	Het
Slc34a2	A	G	5: 53,067,707	T397A	probably benign	Het
Slc51a	T	A	16: 32,475,849	T306S	probably benign	Het
Sorcs3	G	A	19: 48,487,394	V231I	probably benign	Het
Sp100	A	T	1: 85,699,744	I86L	probably damaging	Het
Stard9	T	G	2: 120,696,999	S1246A	possibly damaging	Het
Stxbp5	A	T	10: 9,865,099	S116R	probably damaging	Het
Tas2r105	T	C	6: 131,687,430	I12V	probably benign	Het
Tas2r121	A	G	6: 132,700,362	S216P	probably damaging	Het
Tax1bp1	C	T	6: 52,741,940		probably benign	Het
Tcof1	T	C	18: 60,845,832	D48G	probably damaging	Het
Tex24	A	T	8: 27,344,720	H92L	possibly damaging	Het
Tgm3	C	T	2: 130,026,682		probably benign	Het
Thbs4	T	G	13: 92,758,038	D659A	probably damaging	Het
Tmed11	A	T	5: 108,795,309	M1K	probably null	Het
Tmpo	A	T	10: 91,161,953	C657*	probably null	Het
Unc5a	C	A	13: 55,003,933	N56K	possibly damaging	Het
Urb1	T	C	16: 90,795,448	D308G	possibly damaging	Het
Vav3	A	G	3: 109,647,679	N81S	possibly damaging	Het
Vmn2r108	A	T	17: 20,471,459	D267E	probably benign	Het
Vmn2r17	A	T	5: 109,427,956	H231L	possibly damaging	Het
Wrn	A	G	8: 33,295,006	I446T	possibly damaging	Het
Zfp266	G	A	9: 20,499,799	H361Y	probably damaging	Het

Other mutations in Rictor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00488:Rictor	APN	15	6786590	missense	probably damaging	0.99
IGL00785:Rictor	APN	15	6776950	missense	probably damaging	1.00
IGL00801:Rictor	APN	15	6794534	missense	probably damaging	1.00
IGL01072:Rictor	APN	15	6789562	missense	probably damaging	0.98
IGL01139:Rictor	APN	15	6778268	missense	probably damaging	1.00
IGL01303:Rictor	APN	15	6708638	missense	probably benign	0.10
IGL01307:Rictor	APN	15	6774604	splice site	probably null
IGL01767:Rictor	APN	15	6777384	missense	probably damaging	1.00
IGL01774:Rictor	APN	15	6769777	missense	probably damaging	1.00
IGL01800:Rictor	APN	15	6774701	missense	probably damaging	0.99
IGL02192:Rictor	APN	15	6786414	missense	probably benign	0.00
IGL02503:Rictor	APN	15	6786443	missense	probably benign	0.06
IGL02652:Rictor	APN	15	6776187	critical splice donor site	probably null
IGL02656:Rictor	APN	15	6776920	missense	probably damaging	0.98
IGL02752:Rictor	APN	15	6787371	missense	probably benign	0.02
IGL03000:Rictor	APN	15	6769240	splice site	probably benign
IGL03118:Rictor	APN	15	6759518	missense	possibly damaging	0.93
IGL03182:Rictor	APN	15	6789598	missense	probably benign	0.08
Tense	UTSW	15	6759496	missense	possibly damaging	0.94
Tonus	UTSW	15	6769334	critical splice donor site	probably null
Torrid	UTSW	15	6759572	missense	probably damaging	1.00
R0149:Rictor	UTSW	15	6784107	missense	possibly damaging	0.76
R0288:Rictor	UTSW	15	6786540	missense	probably benign	0.08
R0304:Rictor	UTSW	15	6786371	splice site	probably null
R0336:Rictor	UTSW	15	6776753	critical splice acceptor site	probably null
R0361:Rictor	UTSW	15	6784107	missense	possibly damaging	0.76
R0423:Rictor	UTSW	15	6773900	missense	possibly damaging	0.77
R0453:Rictor	UTSW	15	6708642	missense	probably benign	0.01
R0515:Rictor	UTSW	15	6769301	missense	probably damaging	1.00
R0630:Rictor	UTSW	15	6794492	missense	probably damaging	1.00
R0730:Rictor	UTSW	15	6773986	splice site	probably benign
R0744:Rictor	UTSW	15	6764278	critical splice acceptor site	probably null
R0881:Rictor	UTSW	15	6791670	missense	probably benign
R1114:Rictor	UTSW	15	6794005	nonsense	probably null
R1367:Rictor	UTSW	15	6790638	splice site	probably benign
R1655:Rictor	UTSW	15	6772212	missense	probably benign	0.00
R1678:Rictor	UTSW	15	6756471	missense	probably benign	0.07
R1679:Rictor	UTSW	15	6768090	missense	possibly damaging	0.92
R1754:Rictor	UTSW	15	6735368	missense	probably damaging	1.00
R1757:Rictor	UTSW	15	6773862	missense	possibly damaging	0.95
R1762:Rictor	UTSW	15	6756573	missense	probably benign	0.00
R1914:Rictor	UTSW	15	6759572	missense	probably damaging	1.00
R1915:Rictor	UTSW	15	6759572	missense	probably damaging	1.00
R1994:Rictor	UTSW	15	6776156	missense	probably benign	0.18
R2145:Rictor	UTSW	15	6765107	missense	probably damaging	1.00
R2182:Rictor	UTSW	15	6772204	missense	probably damaging	0.96
R2191:Rictor	UTSW	15	6759614	missense	probably benign	0.04
R2357:Rictor	UTSW	15	6783562	missense	probably damaging	0.99
R2914:Rictor	UTSW	15	6769995	critical splice donor site	probably null
R3082:Rictor	UTSW	15	6774857	missense	probably benign	0.15
R3885:Rictor	UTSW	15	6759610	missense	probably damaging	1.00
R3900:Rictor	UTSW	15	6789473	missense	probably benign	0.01
R4376:Rictor	UTSW	15	6786967	missense	probably benign	0.00
R4611:Rictor	UTSW	15	6787144	missense	possibly damaging	0.75
R4644:Rictor	UTSW	15	6777935	nonsense	probably null
R4718:Rictor	UTSW	15	6783160	missense	possibly damaging	0.81
R4822:Rictor	UTSW	15	6791680	missense	probably benign	0.01
R4980:Rictor	UTSW	15	6781660	missense	probably damaging	1.00
R5034:Rictor	UTSW	15	6768095	missense	probably damaging	0.98
R5179:Rictor	UTSW	15	6795940	missense	probably damaging	1.00
R5386:Rictor	UTSW	15	6789504	missense	probably benign	0.37
R5532:Rictor	UTSW	15	6789565	missense	probably damaging	1.00
R5549:Rictor	UTSW	15	6786910	missense	probably damaging	1.00
R5715:Rictor	UTSW	15	6750716	nonsense	probably null
R5733:Rictor	UTSW	15	6783104	missense	probably benign
R5822:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5848:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5849:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5850:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5854:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5855:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5856:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5936:Rictor	UTSW	15	6784161	missense	probably damaging	0.99
R6155:Rictor	UTSW	15	6793977	missense	probably benign	0.44
R6394:Rictor	UTSW	15	6769309	missense	possibly damaging	0.59
R6549:Rictor	UTSW	15	6796175	missense	probably damaging	1.00
R6611:Rictor	UTSW	15	6750659	missense	probably damaging	1.00
R6657:Rictor	UTSW	15	6759496	missense	possibly damaging	0.94
R6705:Rictor	UTSW	15	6794012	missense	probably benign	0.00
R6819:Rictor	UTSW	15	6796036	critical splice donor site	probably null
R6985:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R6989:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7016:Rictor	UTSW	15	6774880	critical splice donor site	probably null
R7030:Rictor	UTSW	15	6708453	critical splice donor site	probably null
R7066:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7067:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7216:Rictor	UTSW	15	6769301	missense	probably damaging	1.00
R7396:Rictor	UTSW	15	6786981	missense	not run
R7449:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7450:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7452:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7616:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7620:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7643:Rictor	UTSW	15	6769269	nonsense	probably null
R7699:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7700:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7749:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7750:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7751:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7753:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7841:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7894:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7897:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7898:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7937:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7944:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R8062:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R8063:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R8094:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R8119:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R8134:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R8166:Rictor	UTSW	15	6769334	critical splice donor site	probably null
R8324:Rictor	UTSW	15	6745562	missense	probably damaging	1.00
R8343:Rictor	UTSW	15	6778319	critical splice donor site	probably null
R8691:Rictor	UTSW	15	6787032	missense	probably damaging	1.00
R8859:Rictor	UTSW	15	6783586	missense	probably damaging	0.98
R8953:Rictor	UTSW	15	6794447	missense	probably benign	0.39
R8977:Rictor	UTSW	15	6783085	missense	probably benign
R9008:Rictor	UTSW	15	6772129	splice site	probably benign
R9369:Rictor	UTSW	15	6744367	missense	probably benign	0.00
R9563:Rictor	UTSW	15	6768081	missense	possibly damaging	0.83
R9695:Rictor	UTSW	15	6786529	missense	probably benign	0.00
X0020:Rictor	UTSW	15	6756482	missense	probably benign	0.32
X0060:Rictor	UTSW	15	6786552	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATCCAGAAGCGCCTTTATGCCC -3'
(R):5'- TGCTATGTACAACTGAGCCACGAAC -3'

Sequencing Primer
(F):5'- GCGCCTTTATGCCCATGTC -3'
(R):5'- CAAGGCCATCTCCTCCCG -3'

Posted On

2013-10-16