Incidental Mutation 'R0836:Vmn2r108'
ID 77960
Institutional Source Beutler Lab
Gene Symbol Vmn2r108
Ensembl Gene ENSMUSG00000091805
Gene Name vomeronasal 2, receptor 108
Synonyms EG627805
MMRRC Submission 039015-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R0836 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 20682635-20701498 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20691721 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 267 (D267E)
Ref Sequence ENSEMBL: ENSMUSP00000130373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167314]
AlphaFold E9PYS0
Predicted Effect probably benign
Transcript: ENSMUST00000167314
AA Change: D267E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130373
Gene: ENSMUSG00000091805
AA Change: D267E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 6e-33 PFAM
Pfam:NCD3G 510 563 9.2e-22 PFAM
Pfam:7tm_3 593 831 2.2e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.2%
Validation Efficiency 100% (102/102)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik A G 5: 139,349,875 (GRCm39) V58A possibly damaging Het
4932415M13Rik A T 17: 54,031,374 (GRCm39) noncoding transcript Het
A930003A15Rik T C 16: 19,702,622 (GRCm39) noncoding transcript Het
Abca8a A T 11: 109,931,390 (GRCm39) D1253E possibly damaging Het
Acsm3 T C 7: 119,376,323 (GRCm39) I350T possibly damaging Het
Adcy9 T C 16: 4,237,135 (GRCm39) D92G possibly damaging Het
Aldh9a1 G A 1: 167,177,824 (GRCm39) G7D probably benign Het
Alg14 A G 3: 121,092,259 (GRCm39) H34R probably damaging Het
Ankrd27 A G 7: 35,307,772 (GRCm39) N337S probably damaging Het
Apoa2 T A 1: 171,052,948 (GRCm39) probably benign Het
Asphd2 A T 5: 112,539,635 (GRCm39) L66H probably damaging Het
Astl T C 2: 127,184,339 (GRCm39) F21L probably benign Het
Bptf C A 11: 107,001,638 (GRCm39) probably null Het
Cacna2d4 C T 6: 119,284,247 (GRCm39) R745W probably damaging Het
Cadps2 T C 6: 23,328,775 (GRCm39) probably benign Het
Camk4 G T 18: 33,072,507 (GRCm39) S20I unknown Het
Ccdc85a T A 11: 28,533,296 (GRCm39) I83F probably damaging Het
Ccnt2 T A 1: 127,730,131 (GRCm39) M336K probably benign Het
Cd209e G T 8: 3,903,205 (GRCm39) D62E probably benign Het
Ceacam23 C A 7: 17,638,906 (GRCm39) A301E possibly damaging Het
Ces1f A T 8: 93,996,652 (GRCm39) S214T probably damaging Het
Cfap43 C A 19: 47,804,285 (GRCm39) V304L probably benign Het
Col26a1 A G 5: 136,794,154 (GRCm39) probably null Het
Cpa5 T C 6: 30,623,210 (GRCm39) S124P probably damaging Het
Crtc1 A G 8: 70,845,663 (GRCm39) V306A probably benign Het
D130043K22Rik G A 13: 25,047,563 (GRCm39) probably benign Het
D17H6S53E A T 17: 35,346,385 (GRCm39) probably null Het
Dmxl1 T C 18: 49,966,215 (GRCm39) V20A probably damaging Het
Dnah11 G A 12: 118,160,397 (GRCm39) A111V probably benign Het
Dyrk2 T C 10: 118,697,027 (GRCm39) H77R probably benign Het
Epha3 A G 16: 63,423,882 (GRCm39) probably benign Het
Epn2 T C 11: 61,410,317 (GRCm39) N611S probably benign Het
Erich6 A C 3: 58,526,365 (GRCm39) probably benign Het
Fam217b T C 2: 178,062,782 (GRCm39) S249P probably benign Het
Fezf1 T C 6: 23,246,998 (GRCm39) H278R probably benign Het
Fhod3 T A 18: 25,199,275 (GRCm39) Y649N probably damaging Het
Ftdc2 G A 16: 58,455,886 (GRCm39) S129L probably damaging Het
Grap T A 11: 61,551,065 (GRCm39) D32E possibly damaging Het
Hipk1 A G 3: 103,661,612 (GRCm39) S670P probably damaging Het
Iho1 A T 9: 108,282,000 (GRCm39) C563S probably benign Het
Ilrun A T 17: 28,005,112 (GRCm39) S148R probably damaging Het
Itga2 A G 13: 114,993,215 (GRCm39) V800A probably damaging Het
Itgae A T 11: 73,020,032 (GRCm39) M845L probably benign Het
Itgb5 A G 16: 33,720,953 (GRCm39) K339R probably damaging Het
Itpka T A 2: 119,581,312 (GRCm39) N448K probably damaging Het
Jak3 A C 8: 72,136,622 (GRCm39) N643T probably damaging Het
Kcnd2 T A 6: 21,727,328 (GRCm39) V627E probably damaging Het
Kcnd2 T C 6: 21,726,238 (GRCm39) probably benign Het
Ktn1 A G 14: 47,938,519 (GRCm39) probably null Het
Lamp1 T A 8: 13,222,654 (GRCm39) F279L probably damaging Het
Macf1 A G 4: 123,388,675 (GRCm39) probably null Het
Mark2 A G 19: 7,263,189 (GRCm39) Y193H probably damaging Het
Mcrs1 T C 15: 99,141,330 (GRCm39) probably benign Het
Mtnr1a A T 8: 45,540,974 (GRCm39) I312F probably benign Het
Myom2 A T 8: 15,182,924 (GRCm39) K1454* probably null Het
Nfkbia C A 12: 55,537,561 (GRCm39) A211S probably damaging Het
Or52ae9 T C 7: 103,390,132 (GRCm39) H105R probably damaging Het
Or56b1b T C 7: 108,164,205 (GRCm39) T266A possibly damaging Het
Or8b1c A T 9: 38,384,081 (GRCm39) I13F probably benign Het
Otog C T 7: 45,918,786 (GRCm39) T954I possibly damaging Het
Phlpp2 A G 8: 110,663,738 (GRCm39) T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,066,107 (GRCm39) probably benign Het
Plekha5 T A 6: 140,535,360 (GRCm39) probably benign Het
Pmch A G 10: 87,927,086 (GRCm39) I30V probably benign Het
Ppat A C 5: 77,070,348 (GRCm39) Y157D probably benign Het
Ppp1r16a C T 15: 76,577,869 (GRCm39) Q328* probably null Het
Rab27b T C 18: 70,120,112 (GRCm39) probably benign Het
Rapsn T C 2: 90,867,153 (GRCm39) Y152H probably damaging Het
Rasd1 A T 11: 59,855,379 (GRCm39) F85I probably damaging Het
Rbp3 T G 14: 33,678,595 (GRCm39) S848A possibly damaging Het
Rgs1 A T 1: 144,123,671 (GRCm39) S85T probably damaging Het
Rictor A G 15: 6,793,759 (GRCm39) probably null Het
Rims1 T C 1: 22,497,709 (GRCm39) probably null Het
Shc1 A G 3: 89,330,276 (GRCm39) D70G probably damaging Het
Slc22a28 T C 19: 8,094,197 (GRCm39) Y245C possibly damaging Het
Slc25a1 T A 16: 17,745,300 (GRCm39) H78L probably benign Het
Slc30a7 T A 3: 115,783,789 (GRCm39) probably null Het
Slc34a2 A G 5: 53,225,049 (GRCm39) T397A probably benign Het
Slc51a T A 16: 32,294,667 (GRCm39) T306S probably benign Het
Sorcs3 G A 19: 48,475,833 (GRCm39) V231I probably benign Het
Sp100 A T 1: 85,627,465 (GRCm39) I86L probably damaging Het
Spata31e5 A G 1: 28,816,902 (GRCm39) S377P possibly damaging Het
Stard9 T G 2: 120,527,480 (GRCm39) S1246A possibly damaging Het
Stxbp5 A T 10: 9,740,843 (GRCm39) S116R probably damaging Het
Tas2r105 T C 6: 131,664,393 (GRCm39) I12V probably benign Het
Tas2r121 A G 6: 132,677,325 (GRCm39) S216P probably damaging Het
Tax1bp1 C T 6: 52,718,925 (GRCm39) probably benign Het
Tcof1 T C 18: 60,978,904 (GRCm39) D48G probably damaging Het
Tex24 A T 8: 27,834,748 (GRCm39) H92L possibly damaging Het
Tgm3 C T 2: 129,868,602 (GRCm39) probably benign Het
Thbs4 T G 13: 92,894,546 (GRCm39) D659A probably damaging Het
Tmed11 A T 5: 108,943,175 (GRCm39) M1K probably null Het
Tmpo A T 10: 90,997,815 (GRCm39) C657* probably null Het
Unc5a C A 13: 55,151,746 (GRCm39) N56K possibly damaging Het
Urb1 T C 16: 90,592,336 (GRCm39) D308G possibly damaging Het
Vav3 A G 3: 109,554,995 (GRCm39) N81S possibly damaging Het
Vmn2r17 A T 5: 109,575,822 (GRCm39) H231L possibly damaging Het
Wrn A G 8: 33,785,034 (GRCm39) I446T possibly damaging Het
Zfp266 G A 9: 20,411,095 (GRCm39) H361Y probably damaging Het
Other mutations in Vmn2r108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Vmn2r108 APN 17 20,682,774 (GRCm39) missense probably damaging 0.98
IGL01143:Vmn2r108 APN 17 20,682,727 (GRCm39) missense possibly damaging 0.82
IGL01311:Vmn2r108 APN 17 20,682,939 (GRCm39) nonsense probably null
IGL01411:Vmn2r108 APN 17 20,691,282 (GRCm39) missense probably benign 0.01
IGL01414:Vmn2r108 APN 17 20,691,942 (GRCm39) missense probably benign 0.00
IGL01536:Vmn2r108 APN 17 20,683,543 (GRCm39) missense probably damaging 1.00
IGL01748:Vmn2r108 APN 17 20,683,476 (GRCm39) missense probably benign 0.03
IGL01769:Vmn2r108 APN 17 20,691,280 (GRCm39) missense probably benign 0.02
IGL02022:Vmn2r108 APN 17 20,691,987 (GRCm39) missense possibly damaging 0.77
IGL02041:Vmn2r108 APN 17 20,683,398 (GRCm39) missense probably damaging 1.00
IGL02049:Vmn2r108 APN 17 20,691,608 (GRCm39) missense probably benign 0.00
IGL02344:Vmn2r108 APN 17 20,689,405 (GRCm39) missense probably damaging 1.00
IGL02939:Vmn2r108 APN 17 20,691,545 (GRCm39) missense probably benign 0.05
IGL03202:Vmn2r108 APN 17 20,691,319 (GRCm39) nonsense probably null
PIT4498001:Vmn2r108 UTSW 17 20,683,279 (GRCm39) missense probably damaging 1.00
R0112:Vmn2r108 UTSW 17 20,691,897 (GRCm39) missense probably benign 0.07
R0505:Vmn2r108 UTSW 17 20,683,096 (GRCm39) missense possibly damaging 0.77
R0833:Vmn2r108 UTSW 17 20,691,721 (GRCm39) missense probably benign
R0943:Vmn2r108 UTSW 17 20,691,397 (GRCm39) nonsense probably null
R1411:Vmn2r108 UTSW 17 20,683,107 (GRCm39) missense probably damaging 0.98
R1442:Vmn2r108 UTSW 17 20,692,623 (GRCm39) nonsense probably null
R1587:Vmn2r108 UTSW 17 20,692,383 (GRCm39) missense probably damaging 1.00
R1751:Vmn2r108 UTSW 17 20,682,786 (GRCm39) missense probably damaging 1.00
R1773:Vmn2r108 UTSW 17 20,689,335 (GRCm39) missense probably damaging 1.00
R2021:Vmn2r108 UTSW 17 20,691,252 (GRCm39) missense probably benign 0.00
R2159:Vmn2r108 UTSW 17 20,689,363 (GRCm39) missense probably benign 0.41
R2224:Vmn2r108 UTSW 17 20,701,295 (GRCm39) nonsense probably null
R2226:Vmn2r108 UTSW 17 20,701,295 (GRCm39) nonsense probably null
R2517:Vmn2r108 UTSW 17 20,692,577 (GRCm39) missense probably damaging 1.00
R3710:Vmn2r108 UTSW 17 20,682,932 (GRCm39) missense probably benign
R4470:Vmn2r108 UTSW 17 20,682,990 (GRCm39) missense probably damaging 1.00
R4686:Vmn2r108 UTSW 17 20,691,636 (GRCm39) missense probably damaging 0.99
R4729:Vmn2r108 UTSW 17 20,692,632 (GRCm39) missense probably damaging 0.99
R4799:Vmn2r108 UTSW 17 20,682,891 (GRCm39) missense probably damaging 1.00
R4993:Vmn2r108 UTSW 17 20,701,449 (GRCm39) missense probably benign 0.04
R5088:Vmn2r108 UTSW 17 20,690,454 (GRCm39) missense possibly damaging 0.46
R5213:Vmn2r108 UTSW 17 20,691,755 (GRCm39) missense probably benign 0.00
R5289:Vmn2r108 UTSW 17 20,691,866 (GRCm39) missense probably damaging 1.00
R5290:Vmn2r108 UTSW 17 20,691,665 (GRCm39) missense probably benign 0.00
R5713:Vmn2r108 UTSW 17 20,691,290 (GRCm39) missense probably damaging 1.00
R5753:Vmn2r108 UTSW 17 20,683,179 (GRCm39) missense probably damaging 0.99
R5792:Vmn2r108 UTSW 17 20,683,398 (GRCm39) missense probably damaging 0.99
R5798:Vmn2r108 UTSW 17 20,692,545 (GRCm39) missense probably benign 0.39
R5897:Vmn2r108 UTSW 17 20,691,580 (GRCm39) missense probably benign 0.01
R6018:Vmn2r108 UTSW 17 20,683,268 (GRCm39) missense possibly damaging 0.83
R6093:Vmn2r108 UTSW 17 20,701,402 (GRCm39) missense probably benign 0.00
R6156:Vmn2r108 UTSW 17 20,692,447 (GRCm39) missense probably benign 0.03
R6199:Vmn2r108 UTSW 17 20,682,644 (GRCm39) missense probably benign 0.01
R6259:Vmn2r108 UTSW 17 20,683,371 (GRCm39) missense possibly damaging 0.95
R6309:Vmn2r108 UTSW 17 20,691,660 (GRCm39) missense probably damaging 0.98
R6324:Vmn2r108 UTSW 17 20,691,977 (GRCm39) nonsense probably null
R6364:Vmn2r108 UTSW 17 20,691,260 (GRCm39) missense probably benign 0.00
R6446:Vmn2r108 UTSW 17 20,692,609 (GRCm39) nonsense probably null
R6541:Vmn2r108 UTSW 17 20,701,480 (GRCm39) missense probably benign 0.02
R7025:Vmn2r108 UTSW 17 20,691,345 (GRCm39) missense possibly damaging 0.67
R7063:Vmn2r108 UTSW 17 20,701,410 (GRCm39) missense probably damaging 1.00
R7092:Vmn2r108 UTSW 17 20,701,338 (GRCm39) missense probably benign 0.10
R7096:Vmn2r108 UTSW 17 20,682,762 (GRCm39) missense probably damaging 1.00
R7203:Vmn2r108 UTSW 17 20,683,038 (GRCm39) missense probably benign 0.12
R7458:Vmn2r108 UTSW 17 20,692,532 (GRCm39) missense probably benign 0.17
R7619:Vmn2r108 UTSW 17 20,692,457 (GRCm39) missense probably benign 0.02
R7841:Vmn2r108 UTSW 17 20,690,305 (GRCm39) critical splice donor site probably null
R7944:Vmn2r108 UTSW 17 20,691,890 (GRCm39) missense probably damaging 0.99
R8048:Vmn2r108 UTSW 17 20,691,762 (GRCm39) missense probably benign 0.29
R8213:Vmn2r108 UTSW 17 20,690,350 (GRCm39) missense probably benign 0.03
R8218:Vmn2r108 UTSW 17 20,683,465 (GRCm39) missense probably damaging 1.00
R8507:Vmn2r108 UTSW 17 20,683,195 (GRCm39) nonsense probably null
R8708:Vmn2r108 UTSW 17 20,682,687 (GRCm39) missense probably damaging 0.98
R8845:Vmn2r108 UTSW 17 20,691,361 (GRCm39) missense probably benign 0.03
R9030:Vmn2r108 UTSW 17 20,690,312 (GRCm39) missense probably benign 0.01
R9226:Vmn2r108 UTSW 17 20,691,330 (GRCm39) missense probably benign
R9278:Vmn2r108 UTSW 17 20,692,561 (GRCm39) missense probably benign 0.11
X0022:Vmn2r108 UTSW 17 20,691,371 (GRCm39) missense probably damaging 1.00
Z1088:Vmn2r108 UTSW 17 20,691,375 (GRCm39) missense probably benign 0.01
Z1177:Vmn2r108 UTSW 17 20,691,219 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGAGCCACAGCATACACAGC -3'
(R):5'- GATTCCATCTTGAGTGACCGTGGAC -3'

Sequencing Primer
(F):5'- TATGACTAGGTAACACATCCAGAG -3'
(R):5'- GAGTGACCGTGGACAATATTCTTC -3'
Posted On 2013-10-16