Mutagenetix > Incidental Mutation

Incidental Mutation 'R0836:Sorcs3'

77972

Institutional Source

Beutler Lab

Gene Symbol

Sorcs3

Ensembl Gene

ENSMUSG00000063434

Gene Name

sortilin-related VPS10 domain containing receptor 3

Synonyms

6330404A12Rik

MMRRC Submission

039015-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R0836 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48206025-48805505 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 48487394 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 231 (V231I)

Ref Sequence

ENSEMBL: ENSMUSP00000077919 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078880]

AlphaFold

Q8VI51

Predicted Effect

probably benign
Transcript: ENSMUST00000078880
AA Change: V231I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: V231I

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	46	63	N/A	INTRINSIC
low complexity region	69	91	N/A	INTRINSIC
VPS10	216	818	N/A	SMART
Pfam:PKD	823	901	8e-13	PFAM
transmembrane domain	1122	1141	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 96.9%
20x: 92.2%

Validation Efficiency

100% (102/102)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110082I17Rik	A	G	5: 139,364,120	V58A	possibly damaging	Het
4932415M13Rik	A	T	17: 53,724,346		noncoding transcript	Het
A930003A15Rik	T	C	16: 19,883,872		noncoding transcript	Het
Abca8a	A	T	11: 110,040,564	D1253E	possibly damaging	Het
Acsm3	T	C	7: 119,777,100	I350T	possibly damaging	Het
Adcy9	T	C	16: 4,419,271	D92G	possibly damaging	Het
Aldh9a1	G	A	1: 167,350,255	G7D	probably benign	Het
Alg14	A	G	3: 121,298,610	H34R	probably damaging	Het
Ankrd27	A	G	7: 35,608,347	N337S	probably damaging	Het
Apoa2	T	A	1: 171,225,379		probably benign	Het
Asphd2	A	T	5: 112,391,769	L66H	probably damaging	Het
Astl	T	C	2: 127,342,419	F21L	probably benign	Het
Bptf	C	A	11: 107,110,812		probably null	Het
Cacna2d4	C	T	6: 119,307,286	R745W	probably damaging	Het
Cadps2	T	C	6: 23,328,776		probably benign	Het
Camk4	G	T	18: 32,939,454	S20I	unknown	Het
Ccdc36	A	T	9: 108,404,801	C563S	probably benign	Het
Ccdc85a	T	A	11: 28,583,296	I83F	probably damaging	Het
Ccnt2	T	A	1: 127,802,394	M336K	probably benign	Het
Cd209e	G	T	8: 3,853,205	D62E	probably benign	Het
Ces1f	A	T	8: 93,270,024	S214T	probably damaging	Het
Cfap43	C	A	19: 47,815,846	V304L	probably benign	Het
Col26a1	A	G	5: 136,765,300		probably null	Het
Cpa5	T	C	6: 30,623,211	S124P	probably damaging	Het
Crtc1	A	G	8: 70,393,013	V306A	probably benign	Het
D130043K22Rik	G	A	13: 24,863,580		probably benign	Het
D17H6S53E	A	T	17: 35,127,409		probably null	Het
D17Wsu92e	A	T	17: 27,786,138	S148R	probably damaging	Het
Dmxl1	T	C	18: 49,833,148	V20A	probably damaging	Het
Dnah11	G	A	12: 118,196,662	A111V	probably benign	Het
Dyrk2	T	C	10: 118,861,122	H77R	probably benign	Het
E330017A01Rik	G	A	16: 58,635,523	S129L	probably damaging	Het
Epha3	A	G	16: 63,603,519		probably benign	Het
Epn2	T	C	11: 61,519,491	N611S	probably benign	Het
Erich6	A	C	3: 58,618,944		probably benign	Het
Fam217b	T	C	2: 178,420,989	S249P	probably benign	Het
Fezf1	T	C	6: 23,246,999	H278R	probably benign	Het
Fhod3	T	A	18: 25,066,218	Y649N	probably damaging	Het
Gm5155	C	A	7: 17,904,981	A301E	possibly damaging	Het
Gm597	A	G	1: 28,777,821	S377P	possibly damaging	Het
Grap	T	A	11: 61,660,239	D32E	possibly damaging	Het
Hipk1	A	G	3: 103,754,296	S670P	probably damaging	Het
Itga2	A	G	13: 114,856,679	V800A	probably damaging	Het
Itgae	A	T	11: 73,129,206	M845L	probably benign	Het
Itgb5	A	G	16: 33,900,583	K339R	probably damaging	Het
Itpka	T	A	2: 119,750,831	N448K	probably damaging	Het
Jak3	A	C	8: 71,683,978	N643T	probably damaging	Het
Kcnd2	T	C	6: 21,726,239		probably benign	Het
Kcnd2	T	A	6: 21,727,329	V627E	probably damaging	Het
Ktn1	A	G	14: 47,701,062		probably null	Het
Lamp1	T	A	8: 13,172,654	F279L	probably damaging	Het
Macf1	A	G	4: 123,494,882		probably null	Het
Mark2	A	G	19: 7,285,824	Y193H	probably damaging	Het
Mcrs1	T	C	15: 99,243,449		probably benign	Het
Mtnr1a	A	T	8: 45,087,937	I312F	probably benign	Het
Myom2	A	T	8: 15,132,924	K1454*	probably null	Het
Nfkbia	C	A	12: 55,490,776	A211S	probably damaging	Het
Olfr504	T	C	7: 108,564,998	T266A	possibly damaging	Het
Olfr629	T	C	7: 103,740,925	H105R	probably damaging	Het
Olfr905	A	T	9: 38,472,785	I13F	probably benign	Het
Otog	C	T	7: 46,269,362	T954I	possibly damaging	Het
Phlpp2	A	G	8: 109,937,106	T926A	probably damaging	Het
Plec	GGCAGCAG	GGCAGCAGCAG	15: 76,181,907		probably benign	Het
Plekha5	T	A	6: 140,589,634		probably benign	Het
Pmch	A	G	10: 88,091,224	I30V	probably benign	Het
Ppat	A	C	5: 76,922,501	Y157D	probably benign	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Rab27b	T	C	18: 69,987,041		probably benign	Het
Rapsn	T	C	2: 91,036,808	Y152H	probably damaging	Het
Rasd1	A	T	11: 59,964,553	F85I	probably damaging	Het
Rbp3	T	G	14: 33,956,638	S848A	possibly damaging	Het
Rgs1	A	T	1: 144,247,933	S85T	probably damaging	Het
Rictor	A	G	15: 6,764,278		probably null	Het
Rims1	T	C	1: 22,427,459		probably null	Het
Shc1	A	G	3: 89,422,969	D70G	probably damaging	Het
Slc22a28	T	C	19: 8,116,833	Y245C	possibly damaging	Het
Slc25a1	T	A	16: 17,927,436	H78L	probably benign	Het
Slc30a7	T	A	3: 115,990,140		probably null	Het
Slc34a2	A	G	5: 53,067,707	T397A	probably benign	Het
Slc51a	T	A	16: 32,475,849	T306S	probably benign	Het
Sp100	A	T	1: 85,699,744	I86L	probably damaging	Het
Stard9	T	G	2: 120,696,999	S1246A	possibly damaging	Het
Stxbp5	A	T	10: 9,865,099	S116R	probably damaging	Het
Tas2r105	T	C	6: 131,687,430	I12V	probably benign	Het
Tas2r121	A	G	6: 132,700,362	S216P	probably damaging	Het
Tax1bp1	C	T	6: 52,741,940		probably benign	Het
Tcof1	T	C	18: 60,845,832	D48G	probably damaging	Het
Tex24	A	T	8: 27,344,720	H92L	possibly damaging	Het
Tgm3	C	T	2: 130,026,682		probably benign	Het
Thbs4	T	G	13: 92,758,038	D659A	probably damaging	Het
Tmed11	A	T	5: 108,795,309	M1K	probably null	Het
Tmpo	A	T	10: 91,161,953	C657*	probably null	Het
Unc5a	C	A	13: 55,003,933	N56K	possibly damaging	Het
Urb1	T	C	16: 90,795,448	D308G	possibly damaging	Het
Vav3	A	G	3: 109,647,679	N81S	possibly damaging	Het
Vmn2r108	A	T	17: 20,471,459	D267E	probably benign	Het
Vmn2r17	A	T	5: 109,427,956	H231L	possibly damaging	Het
Wrn	A	G	8: 33,295,006	I446T	possibly damaging	Het
Zfp266	G	A	9: 20,499,799	H361Y	probably damaging	Het

Other mutations in Sorcs3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sorcs3	APN	19	48683658	critical splice donor site	probably null
IGL00233:Sorcs3	APN	19	48748319	missense	probably benign	0.12
IGL00482:Sorcs3	APN	19	48603864	missense	probably benign	0.00
IGL00976:Sorcs3	APN	19	48767103	missense	probably damaging	1.00
IGL01367:Sorcs3	APN	19	48796375	missense	probably damaging	1.00
IGL01390:Sorcs3	APN	19	48790131	missense	probably damaging	1.00
IGL01548:Sorcs3	APN	19	48794168	missense	possibly damaging	0.87
IGL02162:Sorcs3	APN	19	48535531	missense	probably damaging	0.98
IGL02165:Sorcs3	APN	19	48654072	missense	probably benign	0.03
IGL02404:Sorcs3	APN	19	48704370	splice site	probably benign
IGL02830:Sorcs3	APN	19	48723002	splice site	probably null
IGL02943:Sorcs3	APN	19	48759938	missense	probably benign	0.00
R0371:Sorcs3	UTSW	19	48603894	missense	probably benign	0.00
R0456:Sorcs3	UTSW	19	48654044	missense	possibly damaging	0.94
R0466:Sorcs3	UTSW	19	48748319	missense	probably benign	0.12
R0470:Sorcs3	UTSW	19	48797517	critical splice donor site	probably null
R0536:Sorcs3	UTSW	19	48802698	nonsense	probably null
R0646:Sorcs3	UTSW	19	48206295	missense	probably benign	0.10
R0709:Sorcs3	UTSW	19	48487406	missense	probably benign
R0792:Sorcs3	UTSW	19	48706009	missense	possibly damaging	0.84
R0831:Sorcs3	UTSW	19	48693994	missense	probably damaging	1.00
R1253:Sorcs3	UTSW	19	48206736	missense	possibly damaging	0.67
R1390:Sorcs3	UTSW	19	48694001	critical splice donor site	probably null
R1522:Sorcs3	UTSW	19	48706009	missense	possibly damaging	0.84
R1570:Sorcs3	UTSW	19	48764181	missense	probably damaging	1.00
R1637:Sorcs3	UTSW	19	48748359	critical splice donor site	probably null
R1766:Sorcs3	UTSW	19	48603875	missense	possibly damaging	0.87
R1894:Sorcs3	UTSW	19	48794274	missense	probably benign	0.23
R2426:Sorcs3	UTSW	19	48722925	missense	probably damaging	1.00
R3789:Sorcs3	UTSW	19	48398711	missense	possibly damaging	0.46
R3818:Sorcs3	UTSW	19	48603904	missense	probably benign	0.00
R3824:Sorcs3	UTSW	19	48722956	missense	probably damaging	1.00
R3934:Sorcs3	UTSW	19	48713504	missense	probably damaging	1.00
R3936:Sorcs3	UTSW	19	48713504	missense	probably damaging	1.00
R4190:Sorcs3	UTSW	19	48749373	missense	possibly damaging	0.69
R4604:Sorcs3	UTSW	19	48693914	missense	probably benign	0.35
R4644:Sorcs3	UTSW	19	48683597	missense	probably damaging	1.00
R4774:Sorcs3	UTSW	19	48794163	missense	probably benign	0.23
R4801:Sorcs3	UTSW	19	48398744	missense	possibly damaging	0.46
R4802:Sorcs3	UTSW	19	48398744	missense	possibly damaging	0.46
R4945:Sorcs3	UTSW	19	48764148	missense	possibly damaging	0.50
R5049:Sorcs3	UTSW	19	48759951	missense	possibly damaging	0.93
R5175:Sorcs3	UTSW	19	48759845	critical splice acceptor site	probably null
R5342:Sorcs3	UTSW	19	48796472	splice site	probably null
R5848:Sorcs3	UTSW	19	48788511	missense	probably damaging	1.00
R5959:Sorcs3	UTSW	19	48749396	missense	probably damaging	1.00
R5977:Sorcs3	UTSW	19	48796450	missense	probably damaging	1.00
R6155:Sorcs3	UTSW	19	48398697	missense	possibly damaging	0.94
R6222:Sorcs3	UTSW	19	48759857	missense	possibly damaging	0.57
R6268:Sorcs3	UTSW	19	48790166	missense	probably damaging	1.00
R6416:Sorcs3	UTSW	19	48802759	missense	probably damaging	1.00
R6425:Sorcs3	UTSW	19	48764307	critical splice donor site	probably null
R6623:Sorcs3	UTSW	19	48788505	missense	probably benign	0.00
R6767:Sorcs3	UTSW	19	48713571	missense	probably damaging	0.99
R6888:Sorcs3	UTSW	19	48693824	missense	possibly damaging	0.83
R6955:Sorcs3	UTSW	19	48749343	missense	possibly damaging	0.82
R7106:Sorcs3	UTSW	19	48705963	missense	probably damaging	1.00
R7379:Sorcs3	UTSW	19	48772266	missense	possibly damaging	0.69
R7953:Sorcs3	UTSW	19	48764295	missense	possibly damaging	0.84
R8043:Sorcs3	UTSW	19	48764295	missense	possibly damaging	0.84
R8242:Sorcs3	UTSW	19	48206474	missense	possibly damaging	0.53
R8343:Sorcs3	UTSW	19	48704369	splice site	probably null
R8433:Sorcs3	UTSW	19	48206474	missense	possibly damaging	0.53
R8435:Sorcs3	UTSW	19	48206474	missense	possibly damaging	0.53
R8436:Sorcs3	UTSW	19	48206474	missense	possibly damaging	0.53
R8940:Sorcs3	UTSW	19	48796469	critical splice donor site	probably null
R8956:Sorcs3	UTSW	19	48749371	nonsense	probably null
R9051:Sorcs3	UTSW	19	48206370	missense	probably benign
R9119:Sorcs3	UTSW	19	48653994	missense	possibly damaging	0.92
R9166:Sorcs3	UTSW	19	48796372	missense	probably benign	0.01
R9328:Sorcs3	UTSW	19	48797511	missense	probably damaging	1.00
R9489:Sorcs3	UTSW	19	48722925	missense	probably damaging	1.00
R9605:Sorcs3	UTSW	19	48722925	missense	probably damaging	1.00
R9757:Sorcs3	UTSW	19	48722924	missense	probably damaging	1.00
X0018:Sorcs3	UTSW	19	48772289	missense	probably damaging	1.00
Z1176:Sorcs3	UTSW	19	48645804	missense	probably damaging	1.00
Z1177:Sorcs3	UTSW	19	48704300	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCAAGCTCCAGCAGCTTCTTTC -3'
(R):5'- CTCTCCACAAGTGGTATGATCGCC -3'

Sequencing Primer
(F):5'- GGAAGAAGGCACATTAGTCTAATTTC -3'
(R):5'- AGTGGTATGATCGCCGTTGTG -3'

Posted On

2013-10-16