Mutagenetix > Incidental Mutation

Incidental Mutation 'R0837:Rb1cc1'

77973

Institutional Source

Beutler Lab

Gene Symbol

Rb1cc1

Ensembl Gene

ENSMUSG00000025907

Gene Name

RB1-inducible coiled-coil 1

Synonyms

Cc1, 2900055E04Rik, LaXp180, 5930404L04Rik, Fip200

MMRRC Submission

039016-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0837 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

6206197-6276648 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 6234271 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027040] [ENSMUST00000159906] [ENSMUST00000160062] [ENSMUST00000160871] [ENSMUST00000162795]

AlphaFold

Q9ESK9

Predicted Effect

probably benign
Transcript: ENSMUST00000027040
AA Change: C81S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000027040
Gene: ENSMUSG00000025907
AA Change: C81S

Domain	Start	End	E-Value	Type
SCOP:d1euvb_	1	51	7e-4	SMART
Blast:UBQ	3	76	8e-12	BLAST
low complexity region	471	486	N/A	INTRINSIC
low complexity region	643	653	N/A	INTRINSIC
low complexity region	658	674	N/A	INTRINSIC
coiled coil region	859	921	N/A	INTRINSIC
low complexity region	1033	1045	N/A	INTRINSIC
low complexity region	1055	1066	N/A	INTRINSIC
SCOP:d1eq1a_	1159	1305	1e-3	SMART
low complexity region	1374	1388	N/A	INTRINSIC
Pfam:ATG11	1447	1583	5.6e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159906
AA Change: C81S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000125396
Gene: ENSMUSG00000025907
AA Change: C81S

Domain	Start	End	E-Value	Type
SCOP:d1euvb_	1	51	5e-6	SMART
Blast:UBQ	3	76	3e-15	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000160062

Predicted Effect

probably benign
Transcript: ENSMUST00000160871
AA Change: C81S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000123768
Gene: ENSMUSG00000025907
AA Change: C81S

Domain	Start	End	E-Value	Type
SCOP:d1euvb_	1	51	1e-5	SMART
Blast:UBQ	3	76	3e-14	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000161327

SMART Domains

Protein: ENSMUSP00000125348
Gene: ENSMUSG00000025907

Domain	Start	End	E-Value	Type
low complexity region	351	366	N/A	INTRINSIC
low complexity region	523	533	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
coiled coil region	738	800	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
low complexity region	935	946	N/A	INTRINSIC
SCOP:d1eq1a_	1039	1174	3e-3	SMART
low complexity region	1254	1268	N/A	INTRINSIC
Pfam:ATG11	1327	1463	6.7e-28	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000161327

SMART Domains

Protein: ENSMUSP00000125348
Gene: ENSMUSG00000025907

Domain	Start	End	E-Value	Type
low complexity region	351	366	N/A	INTRINSIC
low complexity region	523	533	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
coiled coil region	738	800	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
low complexity region	935	946	N/A	INTRINSIC
SCOP:d1eq1a_	1039	1174	3e-3	SMART
low complexity region	1254	1268	N/A	INTRINSIC
Pfam:ATG11	1327	1463	6.7e-28	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000161327

SMART Domains

Protein: ENSMUSP00000125348
Gene: ENSMUSG00000025907

Domain	Start	End	E-Value	Type
low complexity region	351	366	N/A	INTRINSIC
low complexity region	523	533	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
coiled coil region	738	800	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
low complexity region	935	946	N/A	INTRINSIC
SCOP:d1eq1a_	1039	1174	3e-3	SMART
low complexity region	1254	1268	N/A	INTRINSIC
Pfam:ATG11	1327	1463	6.7e-28	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000161327

SMART Domains

Protein: ENSMUSP00000125348
Gene: ENSMUSG00000025907

Domain	Start	End	E-Value	Type
low complexity region	351	366	N/A	INTRINSIC
low complexity region	523	533	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
coiled coil region	738	800	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
low complexity region	935	946	N/A	INTRINSIC
SCOP:d1eq1a_	1039	1174	3e-3	SMART
low complexity region	1254	1268	N/A	INTRINSIC
Pfam:ATG11	1327	1463	6.7e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162210

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162795
AA Change: C81S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000124676
Gene: ENSMUSG00000025907
AA Change: C81S

Domain	Start	End	E-Value	Type
SCOP:d1euvb_	1	51	2e-4	SMART
Blast:UBQ	3	76	4e-12	BLAST
low complexity region	454	469	N/A	INTRINSIC
low complexity region	626	636	N/A	INTRINSIC
low complexity region	641	657	N/A	INTRINSIC
coiled coil region	842	865	N/A	INTRINSIC

Meta Mutation Damage Score

0.0724

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.8%

Validation Efficiency

96% (44/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with signaling pathways to coordinately regulate cell growth, cell proliferation, apoptosis, autophagy, and cell migration. This tumor suppressor also enhances retinoblastoma 1 gene expression in cancer cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at mid/late gestation associated with heart failure and liver degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563I02Rik	T	C	14: 60,095,926		probably benign	Het
4930579C12Rik	A	G	9: 89,168,207		noncoding transcript	Het
Adam34	T	A	8: 43,651,500	K369N	probably benign	Het
Ap1g1	T	C	8: 109,851,065	W481R	probably damaging	Het
Bicdl1	G	A	5: 115,731,292	P26S	probably benign	Het
Cacna1c	A	T	6: 118,630,270	C1224*	probably null	Het
Cpsf2	C	T	12: 101,997,242		probably benign	Het
Cyp11b2	G	A	15: 74,853,641	R210W	probably damaging	Het
Dock7	C	T	4: 98,989,258	V1048I	probably benign	Het
Dync2h1	C	A	9: 7,077,979	A2908S	probably benign	Het
Elane	A	G	10: 79,887,108	D116G	probably damaging	Het
Epb41l2	C	T	10: 25,507,816	R153C	probably damaging	Het
Gucy2c	G	A	6: 136,722,420	P617L	probably damaging	Het
Hist2h2ab	G	A	3: 96,220,123	A70T	probably damaging	Het
Kcnq4	T	A	4: 120,746,861	I106L	probably benign	Het
Man2b1	A	G	8: 85,096,829	N931D	possibly damaging	Het
Mthfs	A	G	9: 89,215,390	E100G	probably damaging	Het
Mto1	A	T	9: 78,473,790	I639F	probably damaging	Het
Myo15	A	G	11: 60,487,251	E177G	probably damaging	Het
Naip5	T	A	13: 100,230,743	M282L	probably benign	Het
Olfr433	A	G	1: 174,042,487	D179G	probably damaging	Het
Pik3c2g	G	A	6: 139,957,699		probably benign	Het
Prl7d1	T	A	13: 27,714,338	M64L	probably benign	Het
Prnp	A	T	2: 131,936,524	N32I	probably damaging	Het
Ptpn11	C	T	5: 121,149,111	V406I	probably benign	Het
Rab40c	G	A	17: 25,884,693	T151I	probably damaging	Het
Rnf145	T	C	11: 44,524,988	V10A	probably benign	Het
Rtn4rl2	T	C	2: 84,880,692	N70S	probably damaging	Het
Scaper	A	T	9: 55,859,042	C483*	probably null	Het
Sema4a	T	A	3: 88,453,098	Q58L	possibly damaging	Het
Slf1	T	C	13: 77,100,948		probably null	Het
Sycp1	G	T	3: 102,915,245	N364K	probably benign	Het
Tenm4	T	C	7: 96,896,275		probably benign	Het
Tnfaip2	A	G	12: 111,450,707	T537A	probably damaging	Het
Trappc12	A	G	12: 28,703,597	I573T	possibly damaging	Het
Ugt2b38	G	A	5: 87,411,773	T420I	probably damaging	Het
Ulk1	A	T	5: 110,789,545		probably benign	Het
Unc80	G	A	1: 66,648,944	C2367Y	possibly damaging	Het
Usp7	C	A	16: 8,703,502	G135C	probably damaging	Het
Vmn2r103	A	G	17: 19,793,927	Y327C	probably damaging	Het
Vmn2r28	T	A	7: 5,488,027	H407L	probably damaging	Het
Zfp804a	A	C	2: 82,259,162	T1112P	probably damaging	Het
Zfr2	A	G	10: 81,245,408	K431E	probably damaging	Het
Zfy1	A	T	Y: 725,850	Y638*	probably null	Het

Other mutations in Rb1cc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Rb1cc1	APN	1	6249506	missense	probably damaging	0.97
IGL00590:Rb1cc1	APN	1	6238296	missense	probably damaging	1.00
IGL00678:Rb1cc1	APN	1	6234085	missense	probably damaging	1.00
IGL00705:Rb1cc1	APN	1	6244133	missense	probably benign	0.00
IGL00957:Rb1cc1	APN	1	6249539	missense	probably damaging	1.00
IGL01363:Rb1cc1	APN	1	6250109	missense	probably benign	0.06
IGL01599:Rb1cc1	APN	1	6248771	nonsense	probably null
IGL01610:Rb1cc1	APN	1	6248481	missense	probably benign	0.03
IGL01929:Rb1cc1	APN	1	6240159	missense	possibly damaging	0.82
IGL01978:Rb1cc1	APN	1	6238368	missense	probably damaging	1.00
IGL02312:Rb1cc1	APN	1	6265623	critical splice donor site	probably null
IGL02471:Rb1cc1	APN	1	6240051	missense	probably benign	0.01
IGL02677:Rb1cc1	APN	1	6249419	missense	probably benign
IGL02702:Rb1cc1	APN	1	6240023	missense	probably damaging	0.99
IGL02816:Rb1cc1	APN	1	6262828	splice site	probably benign
IGL02899:Rb1cc1	APN	1	6264583	missense	probably damaging	1.00
fingerling	UTSW	1	6261032	missense	probably damaging	1.00
tots	UTSW	1	6245637	missense	probably damaging	0.99
IGL02988:Rb1cc1	UTSW	1	6247811	critical splice donor site	probably null
R0020:Rb1cc1	UTSW	1	6264548	missense	possibly damaging	0.86
R0254:Rb1cc1	UTSW	1	6262847	missense	probably damaging	1.00
R0390:Rb1cc1	UTSW	1	6248634	missense	probably damaging	1.00
R0466:Rb1cc1	UTSW	1	6263267	splice site	probably null
R0482:Rb1cc1	UTSW	1	6240323	missense	probably damaging	1.00
R0510:Rb1cc1	UTSW	1	6249171	missense	probably benign	0.00
R0512:Rb1cc1	UTSW	1	6248543	missense	probably damaging	1.00
R0616:Rb1cc1	UTSW	1	6244262	missense	possibly damaging	0.80
R0617:Rb1cc1	UTSW	1	6248790	missense	possibly damaging	0.83
R1399:Rb1cc1	UTSW	1	6249818	missense	probably benign	0.00
R1532:Rb1cc1	UTSW	1	6249734	missense	probably benign	0.00
R1542:Rb1cc1	UTSW	1	6244249	missense	possibly damaging	0.82
R1746:Rb1cc1	UTSW	1	6263013	splice site	probably null
R1764:Rb1cc1	UTSW	1	6214680	intron	probably benign
R1968:Rb1cc1	UTSW	1	6248195	splice site	probably null
R2025:Rb1cc1	UTSW	1	6245309	missense	probably damaging	1.00
R2076:Rb1cc1	UTSW	1	6250038	missense	possibly damaging	0.82
R2101:Rb1cc1	UTSW	1	6249335	missense	probably benign
R2249:Rb1cc1	UTSW	1	6272724	missense	probably damaging	1.00
R3176:Rb1cc1	UTSW	1	6249366	missense	probably benign
R3276:Rb1cc1	UTSW	1	6249366	missense	probably benign
R3716:Rb1cc1	UTSW	1	6270690	critical splice acceptor site	probably null
R3747:Rb1cc1	UTSW	1	6248742	missense	possibly damaging	0.92
R3850:Rb1cc1	UTSW	1	6250113	missense	probably benign	0.22
R3967:Rb1cc1	UTSW	1	6248270	splice site	probably benign
R3969:Rb1cc1	UTSW	1	6248270	splice site	probably benign
R3972:Rb1cc1	UTSW	1	6249000	missense	probably benign	0.00
R4166:Rb1cc1	UTSW	1	6265663	intron	probably benign
R4168:Rb1cc1	UTSW	1	6230024	missense	probably damaging	1.00
R4358:Rb1cc1	UTSW	1	6245637	missense	probably damaging	0.99
R4370:Rb1cc1	UTSW	1	6248547	missense	probably damaging	1.00
R4869:Rb1cc1	UTSW	1	6215021	intron	probably benign
R4945:Rb1cc1	UTSW	1	6249627	missense	probably benign	0.24
R5111:Rb1cc1	UTSW	1	6214634	intron	probably benign
R5175:Rb1cc1	UTSW	1	6248321	missense	probably benign
R5196:Rb1cc1	UTSW	1	6234230	missense	probably damaging	0.99
R5271:Rb1cc1	UTSW	1	6249193	nonsense	probably null
R5341:Rb1cc1	UTSW	1	6215042	intron	probably benign
R5952:Rb1cc1	UTSW	1	6248182	missense	probably benign
R5992:Rb1cc1	UTSW	1	6233996	missense	probably damaging	1.00
R6054:Rb1cc1	UTSW	1	6249834	missense	probably benign	0.01
R6064:Rb1cc1	UTSW	1	6249734	missense	probably benign	0.00
R6313:Rb1cc1	UTSW	1	6244133	missense	probably benign	0.00
R6345:Rb1cc1	UTSW	1	6263257	missense	probably benign	0.00
R6488:Rb1cc1	UTSW	1	6270727	missense	probably damaging	0.97
R6566:Rb1cc1	UTSW	1	6249092	missense	probably benign	0.15
R6739:Rb1cc1	UTSW	1	6234230	missense	probably damaging	0.99
R6829:Rb1cc1	UTSW	1	6249264	missense	probably benign	0.04
R6945:Rb1cc1	UTSW	1	6261032	missense	probably damaging	1.00
R6976:Rb1cc1	UTSW	1	6262902	missense	probably benign	0.01
R7031:Rb1cc1	UTSW	1	6238466	critical splice donor site	probably null
R7066:Rb1cc1	UTSW	1	6250005	missense	possibly damaging	0.69
R7185:Rb1cc1	UTSW	1	6238383	missense	probably damaging	1.00
R7276:Rb1cc1	UTSW	1	6249192	missense	probably benign	0.13
R7448:Rb1cc1	UTSW	1	6245503	missense	probably damaging	1.00
R7463:Rb1cc1	UTSW	1	6249180	missense	probably benign
R7484:Rb1cc1	UTSW	1	6274217	missense	probably damaging	1.00
R7496:Rb1cc1	UTSW	1	6248191	missense	probably null	0.02
R7618:Rb1cc1	UTSW	1	6265558	splice site	probably null
R7681:Rb1cc1	UTSW	1	6240323	missense	probably damaging	1.00
R7774:Rb1cc1	UTSW	1	6248085	missense	possibly damaging	0.63
R7780:Rb1cc1	UTSW	1	6248914	nonsense	probably null
R7947:Rb1cc1	UTSW	1	6248562	missense	probably damaging	1.00
R8057:Rb1cc1	UTSW	1	6245219	missense	probably damaging	1.00
R8094:Rb1cc1	UTSW	1	6263224	nonsense	probably null
R8527:Rb1cc1	UTSW	1	6244875	missense	probably damaging	1.00
R8758:Rb1cc1	UTSW	1	6240227	missense	probably benign	0.10
R8843:Rb1cc1	UTSW	1	6245171	missense	probably damaging	1.00
R8922:Rb1cc1	UTSW	1	6248970	missense	probably benign
R8937:Rb1cc1	UTSW	1	6263217	missense	probably benign
R9018:Rb1cc1	UTSW	1	6249266	missense	probably benign
R9106:Rb1cc1	UTSW	1	6248885	missense
R9127:Rb1cc1	UTSW	1	6262849	missense	probably damaging	1.00
R9130:Rb1cc1	UTSW	1	6244885	missense	probably damaging	0.99
R9311:Rb1cc1	UTSW	1	6240315	missense	probably damaging	1.00
R9365:Rb1cc1	UTSW	1	6244893	missense	probably damaging	1.00
R9563:Rb1cc1	UTSW	1	6244115	missense	probably benign
R9598:Rb1cc1	UTSW	1	6239965	missense	probably damaging	1.00
R9608:Rb1cc1	UTSW	1	6248304	missense	probably benign	0.02
R9659:Rb1cc1	UTSW	1	6248449	missense	probably benign	0.33
R9799:Rb1cc1	UTSW	1	6244902	missense	probably damaging	1.00
Z1088:Rb1cc1	UTSW	1	6249018	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GCTTTCTTAGCAGATGGGAGCAGG -3'
(R):5'- CTGCCACTCGTTGTTCTTTGACAAG -3'

Sequencing Primer
(F):5'- AGCAGGGGCTTTGTTTTTGTATTAAG -3'
(R):5'- TGCTTAATTTTGACTTCTCTGCTATC -3'

Posted On

2013-10-16