Incidental Mutation 'R0837:Olfr433'
ID77975
Institutional Source Beutler Lab
Gene Symbol Olfr433
Ensembl Gene ENSMUSG00000045381
Gene Nameolfactory receptor 433
SynonymsGA_x6K02T2P20D-21133014-21132070, MOR123-1
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R0837 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location174040705-174044411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174042487 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 179 (D179G)
Ref Sequence ENSEMBL: ENSMUSP00000149005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052975] [ENSMUST00000214690]
Predicted Effect probably damaging
Transcript: ENSMUST00000052975
AA Change: D179G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056772
Gene: ENSMUSG00000045381
AA Change: D179G

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 4.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 170 2.9e-8 PFAM
Pfam:7tm_1 41 289 1.3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214690
AA Change: D179G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Olfr433
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01760:Olfr433 APN 1 174042625 missense probably damaging 0.99
IGL02369:Olfr433 APN 1 174041973 missense possibly damaging 0.64
IGL03256:Olfr433 APN 1 174042208 missense probably damaging 1.00
IGL03297:Olfr433 APN 1 174042117 missense probably benign 0.00
R1583:Olfr433 UTSW 1 174042480 missense probably benign 0.11
R1974:Olfr433 UTSW 1 174042588 missense probably damaging 1.00
R2280:Olfr433 UTSW 1 174042521 missense probably benign 0.00
R2897:Olfr433 UTSW 1 174042133 missense probably damaging 1.00
R3022:Olfr433 UTSW 1 174042084 missense probably benign 0.13
R4478:Olfr433 UTSW 1 174042616 missense probably benign 0.00
R6364:Olfr433 UTSW 1 174042212 missense possibly damaging 0.80
R6588:Olfr433 UTSW 1 174042278 missense probably benign 0.01
R7343:Olfr433 UTSW 1 174042853 missense probably damaging 0.98
R7409:Olfr433 UTSW 1 174042533 missense probably benign 0.02
R7714:Olfr433 UTSW 1 174042334 missense probably benign 0.00
R7788:Olfr433 UTSW 1 174042084 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TATCTCCTCACACTGGCAGGGAAC -3'
(R):5'- CTGCTCTGAGGTGAACCCACATAC -3'

Sequencing Primer
(F):5'- CATGACCGAGTGCTACCTGTTAG -3'
(R):5'- GAAGCATAGAACAGTGCAACC -3'
Posted On2013-10-16