Incidental Mutation 'R0837:Zfp804a'
ID77976
Institutional Source Beutler Lab
Gene Symbol Zfp804a
Ensembl Gene ENSMUSG00000070866
Gene Namezinc finger protein 804A
Synonyms
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R0837 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location82053222-82259879 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 82259162 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 1112 (T1112P)
Ref Sequence ENSEMBL: ENSMUSP00000041941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047527]
Predicted Effect probably damaging
Transcript: ENSMUST00000047527
AA Change: T1112P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041941
Gene: ENSMUSG00000070866
AA Change: T1112P

DomainStartEndE-ValueType
ZnF_C2H2 57 81 7.29e0 SMART
low complexity region 588 595 N/A INTRINSIC
low complexity region 801 808 N/A INTRINSIC
low complexity region 1012 1029 N/A INTRINSIC
low complexity region 1061 1077 N/A INTRINSIC
low complexity region 1168 1191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127187
Meta Mutation Damage Score 0.1055 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger binding protein. Polymorphisms in this gene, especially rs1344706, are thought to confer increased susceptibility to schizophrenia, bipolar disorder, and heroin addiciton. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Zfp804a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Zfp804a APN 2 82053875 missense probably benign 0.30
IGL02011:Zfp804a APN 2 82256691 missense probably damaging 1.00
IGL02218:Zfp804a APN 2 82259202 missense probably damaging 1.00
IGL02645:Zfp804a APN 2 82053876 missense possibly damaging 0.94
PIT4431001:Zfp804a UTSW 2 82259192 missense probably benign 0.04
R0027:Zfp804a UTSW 2 82257200 missense probably damaging 1.00
R0167:Zfp804a UTSW 2 82256516 missense probably damaging 1.00
R0437:Zfp804a UTSW 2 82053791 start codon destroyed probably null 0.08
R0521:Zfp804a UTSW 2 82259417 nonsense probably null
R0546:Zfp804a UTSW 2 82258920 missense possibly damaging 0.91
R0609:Zfp804a UTSW 2 82257588 missense probably damaging 1.00
R0694:Zfp804a UTSW 2 82053804 missense probably damaging 1.00
R0947:Zfp804a UTSW 2 82258718 missense possibly damaging 0.58
R1103:Zfp804a UTSW 2 82257500 missense probably damaging 0.99
R1168:Zfp804a UTSW 2 82256697 missense probably benign 0.43
R1365:Zfp804a UTSW 2 82257246 missense probably benign 0.00
R1377:Zfp804a UTSW 2 82258497 missense probably benign 0.39
R1501:Zfp804a UTSW 2 82235799 missense probably damaging 1.00
R1526:Zfp804a UTSW 2 82258188 missense probably benign
R1585:Zfp804a UTSW 2 82053751 start gained probably benign
R1674:Zfp804a UTSW 2 82258824 missense probably benign 0.35
R2058:Zfp804a UTSW 2 82257366 missense probably benign 0.00
R2146:Zfp804a UTSW 2 82258664 missense probably benign 0.02
R2149:Zfp804a UTSW 2 82258664 missense probably benign 0.02
R2171:Zfp804a UTSW 2 82257183 missense possibly damaging 0.77
R2307:Zfp804a UTSW 2 82256857 missense probably benign 0.04
R2398:Zfp804a UTSW 2 82258669 missense possibly damaging 0.95
R2496:Zfp804a UTSW 2 82235844 missense probably damaging 1.00
R2504:Zfp804a UTSW 2 82257519 missense probably benign 0.00
R2919:Zfp804a UTSW 2 82235816 missense probably damaging 1.00
R2943:Zfp804a UTSW 2 82235879 missense probably damaging 1.00
R3116:Zfp804a UTSW 2 82259417 missense probably damaging 1.00
R4170:Zfp804a UTSW 2 82253488 missense probably damaging 1.00
R4393:Zfp804a UTSW 2 82256921 missense probably benign 0.43
R4701:Zfp804a UTSW 2 82256582 missense probably damaging 1.00
R4771:Zfp804a UTSW 2 82257942 missense probably benign 0.01
R4793:Zfp804a UTSW 2 82235842 missense probably damaging 1.00
R5523:Zfp804a UTSW 2 82258995 missense probably damaging 1.00
R5526:Zfp804a UTSW 2 82258590 missense probably benign 0.00
R5961:Zfp804a UTSW 2 82258002 missense probably benign
R6181:Zfp804a UTSW 2 82257142 missense probably damaging 1.00
R6209:Zfp804a UTSW 2 82258118 missense probably damaging 1.00
R6325:Zfp804a UTSW 2 82257038 missense possibly damaging 0.80
R7147:Zfp804a UTSW 2 82258187 missense probably benign 0.00
R7229:Zfp804a UTSW 2 82258625 missense probably benign 0.04
R7666:Zfp804a UTSW 2 82259060 nonsense probably null
R7910:Zfp804a UTSW 2 82256573 missense probably damaging 1.00
R8256:Zfp804a UTSW 2 82053849 missense probably damaging 0.99
R8669:Zfp804a UTSW 2 82257762 missense probably damaging 1.00
R8738:Zfp804a UTSW 2 82259106 missense probably damaging 1.00
R8749:Zfp804a UTSW 2 82257575 missense probably benign 0.18
R8751:Zfp804a UTSW 2 82235846 missense probably damaging 0.96
R8828:Zfp804a UTSW 2 82259115 missense possibly damaging 0.74
R8834:Zfp804a UTSW 2 82259097 missense possibly damaging 0.76
R8924:Zfp804a UTSW 2 82258403 missense probably benign 0.03
X0064:Zfp804a UTSW 2 82235823 missense probably damaging 1.00
Z1177:Zfp804a UTSW 2 82258563 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TCCATTGCCTTTACCAGAGCAAGC -3'
(R):5'- TGATTGGCATCTGAGGAGAAGCAAC -3'

Sequencing Primer
(F):5'- ATCTACCATGTGAGGTCTACCAG -3'
(R):5'- TCTGAGGAGAAGCAACCAAAGC -3'
Posted On2013-10-16