Incidental Mutation 'R0837:Rtn4rl2'
ID 77977
Institutional Source Beutler Lab
Gene Symbol Rtn4rl2
Ensembl Gene ENSMUSG00000050896
Gene Name reticulon 4 receptor-like 2
Synonyms Ngrl3, Ngr2, Ngrh1
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.669) question?
Stock # R0837 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 84871924-84886710 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84880692 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 70 (N70S)
Ref Sequence ENSEMBL: ENSMUSP00000057725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054514] [ENSMUST00000151799]
AlphaFold Q7M6Z0
Predicted Effect probably damaging
Transcript: ENSMUST00000054514
AA Change: N70S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057725
Gene: ENSMUSG00000050896
AA Change: N70S

DomainStartEndE-ValueType
LRRNT 30 64 1.45e-1 SMART
LRR 63 82 2.47e1 SMART
LRR 83 104 6.58e0 SMART
LRR 105 129 2.32e-1 SMART
LRR_TYP 130 153 2.4e-3 SMART
LRR_TYP 154 177 2.71e-2 SMART
LRR_TYP 178 201 1.36e-2 SMART
LRR_TYP 202 225 4.72e-2 SMART
LRR 226 249 1.25e-1 SMART
LRRCT 261 311 3.1e-7 SMART
low complexity region 367 378 N/A INTRINSIC
low complexity region 405 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151759
Predicted Effect probably damaging
Transcript: ENSMUST00000151799
AA Change: N76S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118362
Gene: ENSMUSG00000050896
AA Change: N76S

DomainStartEndE-ValueType
LRRNT 36 70 1.45e-1 SMART
LRR 69 88 2.47e1 SMART
LRR 89 110 6.58e0 SMART
LRR 111 135 2.32e-1 SMART
LRR_TYP 136 159 2.4e-3 SMART
LRR_TYP 160 183 2.71e-2 SMART
LRR_TYP 184 207 1.36e-2 SMART
LRR_TYP 208 231 4.72e-2 SMART
LRR 232 255 1.25e-1 SMART
LRRCT 267 317 3.1e-7 SMART
low complexity region 373 384 N/A INTRINSIC
low complexity region 411 426 N/A INTRINSIC
Meta Mutation Damage Score 0.8831 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Rtn4rl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0626:Rtn4rl2 UTSW 2 84880419 missense probably damaging 0.99
R1392:Rtn4rl2 UTSW 2 84880512 missense probably damaging 1.00
R1392:Rtn4rl2 UTSW 2 84880512 missense probably damaging 1.00
R3433:Rtn4rl2 UTSW 2 84872100 missense probably damaging 1.00
R3857:Rtn4rl2 UTSW 2 84880386 critical splice donor site probably null
R3858:Rtn4rl2 UTSW 2 84880386 critical splice donor site probably null
R5044:Rtn4rl2 UTSW 2 84872502 missense probably damaging 1.00
R5936:Rtn4rl2 UTSW 2 84880431 missense probably damaging 1.00
R6800:Rtn4rl2 UTSW 2 84880623 missense probably damaging 1.00
R7755:Rtn4rl2 UTSW 2 84872463 missense possibly damaging 0.82
R8375:Rtn4rl2 UTSW 2 84880689 missense possibly damaging 0.88
R8416:Rtn4rl2 UTSW 2 84872607 missense probably damaging 1.00
R8805:Rtn4rl2 UTSW 2 84872214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCAACGATACAGGTGTAGTGAC -3'
(R):5'- TGCACAGTCTCAGTCTTGCAGC -3'

Sequencing Primer
(F):5'- TCTCCAGACCCTGGAAGGTG -3'
(R):5'- aggaaggtagaggcaggag -3'
Posted On 2013-10-16