Incidental Mutation 'R0837:Prnp'
ID77978
Institutional Source Beutler Lab
Gene Symbol Prnp
Ensembl Gene ENSMUSG00000079037
Gene Nameprion protein
SynonymsPrPC, Sinc, Prn-i, PrP, CD230, Prn-p, PrPSc
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.316) question?
Stock #R0837 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location131909928-131938429 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131936524 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 32 (N32I)
Ref Sequence ENSEMBL: ENSMUSP00000088833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091288] [ENSMUST00000124100] [ENSMUST00000136783]
PDB Structure PRION PROTEIN DOMAIN PRP(121-231) FROM MOUSE, NMR, 2 MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
mouse prion protein fragment 121-231 [SOLUTION NMR]
Mouse Prion Protein with mutation N174T [SOLUTION NMR]
mouse prion protein with mutations S170N and N174T [SOLUTION NMR]
Mouse Prion Protein (121-231) with Mutation S170N [SOLUTION NMR]
Mouse Prion Protein (121-231) with Mutations Y225A and Y226A [SOLUTION NMR]
Mouse Prion Protein (121-231) with Mutation V166A [SOLUTION NMR]
Mouse Prion Protein (121-231) with mutation D167S [SOLUTION NMR]
Mouse Prion Protein (121-231) with mutations D167S and N173K [SOLUTION NMR]
Mouse prion protein (121-231) containing the substitution Y169G [SOLUTION NMR]
>> 11 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000091288
AA Change: N32I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088833
Gene: ENSMUSG00000079037
AA Change: N32I

DomainStartEndE-ValueType
PRP 23 241 7.26e-181 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124100
SMART Domains Protein: ENSMUSP00000116195
Gene: ENSMUSG00000098754

DomainStartEndE-ValueType
Pfam:Doppel 1 30 2.5e-22 PFAM
Pfam:Prion 64 179 4.4e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136783
SMART Domains Protein: ENSMUSP00000122345
Gene: ENSMUSG00000098754

DomainStartEndE-ValueType
Pfam:Doppel 1 30 2.5e-22 PFAM
Pfam:Prion 64 179 4.4e-54 PFAM
Meta Mutation Damage Score 0.3911 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane glycosylphosphatidylinositol-anchored glycoprotein that tends to aggregate into rod-like structures. The encoded protein contains a highly unstable region of five tandem octapeptide repeats. This gene is found on chromosome 20, approximately 20 kbp upstream of a gene which encodes a biochemically and structurally similar protein to the one encoded by this gene. Mutations in the repeat region as well as elsewhere in this gene have been associated with Creutzfeldt-Jakob disease, fatal familial insomnia, Gerstmann-Straussler disease, Huntington disease-like 1, and kuru. An overlapping open reading frame has been found for this gene that encodes a smaller, structurally unrelated protein, AltPrp. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mutations at this locus affect resistance to scrapie infection and spongiform encephalopathy and/or alter scrapie incubation time. Homozygous mutants also show impaired locomotor coordination and reduced mitochondria numbers with unusual morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Prnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Prnp APN 2 131937111 missense probably benign
IGL01081:Prnp APN 2 131936420 intron probably benign
IGL01820:Prnp APN 2 131937070 missense probably benign 0.05
R2303:Prnp UTSW 2 131937126 missense probably benign 0.00
R5214:Prnp UTSW 2 131937004 missense probably damaging 1.00
R5562:Prnp UTSW 2 131937031 missense probably damaging 1.00
R6859:Prnp UTSW 2 131936788 missense possibly damaging 0.93
R7589:Prnp UTSW 2 131936866 missense probably benign 0.22
R8163:Prnp UTSW 2 131936988 missense probably benign 0.01
R8420:Prnp UTSW 2 131936749 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACCTTCAGCCTAAATACTGGGCAC -3'
(R):5'- GTTTTCACGGTAGTAGCGGTCCTC -3'

Sequencing Primer
(F):5'- ATACTGGGCACTGATACCTTG -3'
(R):5'- TCCCAGTCGTTGCCAAAATG -3'
Posted On2013-10-16