Incidental Mutation 'R0837:Sycp1'
ID77981
Institutional Source Beutler Lab
Gene Symbol Sycp1
Ensembl Gene ENSMUSG00000027855
Gene Namesynaptonemal complex protein 1
SynonymsSCP1
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.514) question?
Stock #R0837 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location102818499-102936100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 102915245 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 364 (N364K)
Ref Sequence ENSEMBL: ENSMUSP00000143651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029448] [ENSMUST00000196988]
Predicted Effect probably benign
Transcript: ENSMUST00000029448
AA Change: N364K

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029448
Gene: ENSMUSG00000027855
AA Change: N364K

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196988
AA Change: N364K

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143651
Gene: ENSMUSG00000027855
AA Change: N364K

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype PHENOTYPE: Homozygous null mice display male and female infertility, azoospermia, small ovary, small testis and seminiferous tubules, absent ovarian follicles, and failure of synapse formation during meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Sycp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Sycp1 APN 3 102840962 missense probably benign
IGL00833:Sycp1 APN 3 102876301 critical splice donor site probably null
IGL01066:Sycp1 APN 3 102920634 missense probably damaging 1.00
IGL01484:Sycp1 APN 3 102915867 missense probably benign 0.01
IGL02139:Sycp1 APN 3 102865114 missense probably benign 0.00
IGL02270:Sycp1 APN 3 102895943 missense probably benign 0.12
IGL02347:Sycp1 APN 3 102893547 missense probably benign 0.00
IGL02630:Sycp1 APN 3 102878764 splice site probably benign
IGL02668:Sycp1 APN 3 102820531 splice site probably benign
IGL02928:Sycp1 APN 3 102818818 utr 3 prime probably benign
PIT4458001:Sycp1 UTSW 3 102934833 missense probably benign 0.01
R0027:Sycp1 UTSW 3 102895910 missense probably benign
R0282:Sycp1 UTSW 3 102915795 splice site probably benign
R0462:Sycp1 UTSW 3 102819106 missense possibly damaging 0.75
R0609:Sycp1 UTSW 3 102898849 splice site probably null
R1301:Sycp1 UTSW 3 102920622 missense probably benign 0.02
R2408:Sycp1 UTSW 3 102925259 missense probably damaging 1.00
R2449:Sycp1 UTSW 3 102925206 missense probably benign 0.15
R2516:Sycp1 UTSW 3 102845066 missense probably benign 0.09
R2880:Sycp1 UTSW 3 102818898 missense probably damaging 0.99
R3410:Sycp1 UTSW 3 102841041 missense possibly damaging 0.94
R3427:Sycp1 UTSW 3 102876350 missense probably benign 0.00
R4538:Sycp1 UTSW 3 102840962 missense probably benign
R4679:Sycp1 UTSW 3 102922462 critical splice acceptor site probably null
R4707:Sycp1 UTSW 3 102853489 missense possibly damaging 0.92
R4785:Sycp1 UTSW 3 102853489 missense possibly damaging 0.92
R5017:Sycp1 UTSW 3 102895987 splice site probably null
R5036:Sycp1 UTSW 3 102820600 missense probably damaging 1.00
R5044:Sycp1 UTSW 3 102845054 missense probably benign 0.03
R5070:Sycp1 UTSW 3 102920565 missense probably damaging 0.97
R5079:Sycp1 UTSW 3 102878800 missense possibly damaging 0.67
R5289:Sycp1 UTSW 3 102934253 missense possibly damaging 0.85
R5393:Sycp1 UTSW 3 102841047 splice site probably null
R5477:Sycp1 UTSW 3 102818890 missense probably damaging 1.00
R5576:Sycp1 UTSW 3 102818902 missense probably damaging 0.98
R5814:Sycp1 UTSW 3 102895897 missense probably benign 0.03
R6291:Sycp1 UTSW 3 102908961 missense probably damaging 1.00
R6460:Sycp1 UTSW 3 102925253 missense probably damaging 1.00
R6527:Sycp1 UTSW 3 102898887 missense probably benign 0.09
R6870:Sycp1 UTSW 3 102935603 missense probably damaging 1.00
R6873:Sycp1 UTSW 3 102840980 missense probably benign
R7037:Sycp1 UTSW 3 102898934 missense possibly damaging 0.62
R7210:Sycp1 UTSW 3 102853492 missense probably damaging 1.00
R7405:Sycp1 UTSW 3 102925227 missense possibly damaging 0.72
R7604:Sycp1 UTSW 3 102913433 missense probably damaging 0.98
R7733:Sycp1 UTSW 3 102895962 missense probably benign 0.00
R7858:Sycp1 UTSW 3 102898957 missense probably benign 0.09
R7909:Sycp1 UTSW 3 102820626 nonsense probably null
R8109:Sycp1 UTSW 3 102851602 missense probably benign 0.21
R8141:Sycp1 UTSW 3 102935569 missense possibly damaging 0.73
R8289:Sycp1 UTSW 3 102841037 missense probably benign 0.01
R8359:Sycp1 UTSW 3 102820593 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGGAACTTTTCCAAAGAATGCCTGA -3'
(R):5'- TGGAGAGAACTGTGTGGGCTAACT -3'

Sequencing Primer
(F):5'- CCAAAGAATGCCTGATTTTTAATGG -3'
(R):5'- GCTAACTGCATGGGAAATCTCTG -3'
Posted On2013-10-16