Incidental Mutation 'R0837:Kcnq4'
ID 77983
Institutional Source Beutler Lab
Gene Symbol Kcnq4
Ensembl Gene ENSMUSG00000028631
Gene Name potassium voltage-gated channel, subfamily Q, member 4
Synonyms
MMRRC Submission 039016-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.363) question?
Stock # R0837 (G1)
Quality Score 163
Status Validated
Chromosome 4
Chromosomal Location 120696138-120748612 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120746861 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 106 (I106L)
Ref Sequence ENSEMBL: ENSMUSP00000030376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030376]
AlphaFold Q9JK97
Predicted Effect probably benign
Transcript: ENSMUST00000030376
AA Change: I106L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000030376
Gene: ENSMUSG00000028631
AA Change: I106L

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 36 77 N/A INTRINSIC
Pfam:Ion_trans 99 331 1.2e-28 PFAM
Pfam:Ion_trans_2 244 324 5.4e-16 PFAM
Pfam:KCNQ_channel 465 655 1.6e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129478
Meta Mutation Damage Score 0.0718 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a potassium channel that is thought to play a critical role in the regulation of neuronal excitability, particularly in sensory cells of the cochlea. The current generated by this channel is inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. The encoded protein can form a homomultimeric potassium channel or possibly a heteromultimeric channel in association with the protein encoded by the KCNQ3 gene. Defects in this gene are a cause of nonsyndromic sensorineural deafness type 2 (DFNA2), an autosomal dominant form of progressive hearing loss. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either homozygous for a knock-out allele or homozygous for a dominant negative knock-in allele exhibit a slowly progressive hearing loss due to chronic depolarization and subsequent degeneration of cochlear outer hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 (GRCm38) probably benign Het
4930579C12Rik A G 9: 89,168,207 (GRCm38) noncoding transcript Het
Adam34 T A 8: 43,651,500 (GRCm38) K369N probably benign Het
Ap1g1 T C 8: 109,851,065 (GRCm38) W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 (GRCm38) P26S probably benign Het
Cacna1c A T 6: 118,630,270 (GRCm38) C1224* probably null Het
Cpsf2 C T 12: 101,997,242 (GRCm38) probably benign Het
Cyp11b2 G A 15: 74,853,641 (GRCm38) R210W probably damaging Het
Dock7 C T 4: 98,989,258 (GRCm38) V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 (GRCm38) A2908S probably benign Het
Elane A G 10: 79,887,108 (GRCm38) D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 (GRCm38) R153C probably damaging Het
Gucy2c G A 6: 136,722,420 (GRCm38) P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 (GRCm38) A70T probably damaging Het
Man2b1 A G 8: 85,096,829 (GRCm38) N931D possibly damaging Het
Mthfs A G 9: 89,215,390 (GRCm38) E100G probably damaging Het
Mto1 A T 9: 78,473,790 (GRCm38) I639F probably damaging Het
Myo15 A G 11: 60,487,251 (GRCm38) E177G probably damaging Het
Naip5 T A 13: 100,230,743 (GRCm38) M282L probably benign Het
Olfr433 A G 1: 174,042,487 (GRCm38) D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 (GRCm38) probably benign Het
Prl7d1 T A 13: 27,714,338 (GRCm38) M64L probably benign Het
Prnp A T 2: 131,936,524 (GRCm38) N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 (GRCm38) V406I probably benign Het
Rab40c G A 17: 25,884,693 (GRCm38) T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 (GRCm38) probably null Het
Rnf145 T C 11: 44,524,988 (GRCm38) V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 (GRCm38) N70S probably damaging Het
Scaper A T 9: 55,859,042 (GRCm38) C483* probably null Het
Sema4a T A 3: 88,453,098 (GRCm38) Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 (GRCm38) probably null Het
Sycp1 G T 3: 102,915,245 (GRCm38) N364K probably benign Het
Tenm4 T C 7: 96,896,275 (GRCm38) probably benign Het
Tnfaip2 A G 12: 111,450,707 (GRCm38) T537A probably damaging Het
Trappc12 A G 12: 28,703,597 (GRCm38) I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 (GRCm38) T420I probably damaging Het
Ulk1 A T 5: 110,789,545 (GRCm38) probably benign Het
Unc80 G A 1: 66,648,944 (GRCm38) C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 (GRCm38) G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 (GRCm38) Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 (GRCm38) H407L probably damaging Het
Zfp804a A C 2: 82,259,162 (GRCm38) T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 (GRCm38) K431E probably damaging Het
Zfy1 A T Y: 725,850 (GRCm38) Y638* probably null Het
Other mutations in Kcnq4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Kcnq4 APN 4 120,698,016 (GRCm38) nonsense probably null
IGL00225:Kcnq4 APN 4 120,698,016 (GRCm38) nonsense probably null
IGL00228:Kcnq4 APN 4 120,698,016 (GRCm38) nonsense probably null
IGL00310:Kcnq4 APN 4 120,698,016 (GRCm38) nonsense probably null
IGL00330:Kcnq4 APN 4 120,698,016 (GRCm38) nonsense probably null
IGL00333:Kcnq4 APN 4 120,698,016 (GRCm38) nonsense probably null
IGL00335:Kcnq4 APN 4 120,698,016 (GRCm38) nonsense probably null
IGL00336:Kcnq4 APN 4 120,698,016 (GRCm38) nonsense probably null
IGL01143:Kcnq4 APN 4 120,698,623 (GRCm38) missense probably damaging 1.00
IGL01373:Kcnq4 APN 4 120,717,032 (GRCm38) missense probably damaging 1.00
IGL02095:Kcnq4 APN 4 120,700,027 (GRCm38) splice site probably benign
IGL02335:Kcnq4 APN 4 120,715,854 (GRCm38) missense probably damaging 1.00
IGL03188:Kcnq4 APN 4 120,704,426 (GRCm38) missense possibly damaging 0.81
R0045:Kcnq4 UTSW 4 120,697,955 (GRCm38) missense probably damaging 0.99
R0045:Kcnq4 UTSW 4 120,697,955 (GRCm38) missense probably damaging 0.99
R0423:Kcnq4 UTSW 4 120,717,508 (GRCm38) missense probably damaging 1.00
R0483:Kcnq4 UTSW 4 120,716,601 (GRCm38) missense probably damaging 1.00
R1722:Kcnq4 UTSW 4 120,702,427 (GRCm38) missense probably benign 0.00
R1826:Kcnq4 UTSW 4 120,704,504 (GRCm38) missense probably benign 0.00
R2059:Kcnq4 UTSW 4 120,698,002 (GRCm38) missense probably benign 0.00
R4327:Kcnq4 UTSW 4 120,711,364 (GRCm38) missense probably benign 0.00
R4690:Kcnq4 UTSW 4 120,717,011 (GRCm38) missense probably damaging 0.99
R4706:Kcnq4 UTSW 4 120,704,486 (GRCm38) missense probably benign
R4729:Kcnq4 UTSW 4 120,713,074 (GRCm38) missense possibly damaging 0.47
R4806:Kcnq4 UTSW 4 120,713,094 (GRCm38) missense probably damaging 1.00
R4859:Kcnq4 UTSW 4 120,716,613 (GRCm38) missense probably damaging 1.00
R4885:Kcnq4 UTSW 4 120,713,063 (GRCm38) missense probably benign 0.01
R5073:Kcnq4 UTSW 4 120,717,517 (GRCm38) missense probably damaging 1.00
R5517:Kcnq4 UTSW 4 120,715,809 (GRCm38) missense possibly damaging 0.66
R5590:Kcnq4 UTSW 4 120,715,885 (GRCm38) missense probably damaging 0.98
R5653:Kcnq4 UTSW 4 120,702,411 (GRCm38) missense probably benign 0.00
R5750:Kcnq4 UTSW 4 120,715,049 (GRCm38) missense probably damaging 1.00
R6141:Kcnq4 UTSW 4 120,715,869 (GRCm38) missense probably damaging 1.00
R6160:Kcnq4 UTSW 4 120,716,559 (GRCm38) missense probably damaging 1.00
R7087:Kcnq4 UTSW 4 120,704,399 (GRCm38) missense probably damaging 0.96
R7088:Kcnq4 UTSW 4 120,704,399 (GRCm38) missense probably damaging 0.96
R7143:Kcnq4 UTSW 4 120,711,239 (GRCm38) missense probably benign 0.05
R7225:Kcnq4 UTSW 4 120,746,914 (GRCm38) missense probably benign 0.03
R7479:Kcnq4 UTSW 4 120,715,825 (GRCm38) missense probably damaging 0.98
R7574:Kcnq4 UTSW 4 120,711,368 (GRCm38) missense probably benign
R7879:Kcnq4 UTSW 4 120,702,435 (GRCm38) missense probably benign 0.13
R7980:Kcnq4 UTSW 4 120,711,297 (GRCm38) missense probably benign 0.02
R9007:Kcnq4 UTSW 4 120,697,953 (GRCm38) missense probably benign 0.01
R9421:Kcnq4 UTSW 4 120,716,671 (GRCm38) missense possibly damaging 0.48
R9468:Kcnq4 UTSW 4 120,711,297 (GRCm38) missense probably benign 0.02
R9774:Kcnq4 UTSW 4 120,715,879 (GRCm38) missense probably damaging 0.99
X0020:Kcnq4 UTSW 4 120,715,327 (GRCm38) missense probably damaging 1.00
Z1176:Kcnq4 UTSW 4 120,698,497 (GRCm38) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTAGGTCAGGCTGGGAGACCGA -3'
(R):5'- TTCGAGCCATGCGACTCTGAGC -3'

Sequencing Primer
(F):5'- GACCGAAAAGGGGGCAC -3'
(R):5'- GGCCGTGCAGAGTGAAC -3'
Posted On 2013-10-16