Mutagenetix > Incidental Mutation

Incidental Mutation 'R0837:Ugt2b38'

77985

Institutional Source

Beutler Lab

Gene Symbol

Ugt2b38

Ensembl Gene

ENSMUSG00000061906

Gene Name

UDP glucuronosyltransferase 2 family, polypeptide B38

Synonyms

MMRRC Submission

039016-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R0837 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87409942-87424203 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 87411773 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 420 (T420I)

Ref Sequence

ENSEMBL: ENSMUSP00000072598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072818]

AlphaFold

Q91WH2

Predicted Effect

probably damaging
Transcript: ENSMUST00000072818
AA Change: T420I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000072598
Gene: ENSMUSG00000061906
AA Change: T420I

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:UDPGT	24	527	4.1e-255	PFAM
Pfam:Glyco_tran_28_C	330	444	1.2e-7	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.8%

Validation Efficiency

96% (44/46)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563I02Rik	T	C	14: 60,095,926		probably benign	Het
4930579C12Rik	A	G	9: 89,168,207		noncoding transcript	Het
Adam34	T	A	8: 43,651,500	K369N	probably benign	Het
Ap1g1	T	C	8: 109,851,065	W481R	probably damaging	Het
Bicdl1	G	A	5: 115,731,292	P26S	probably benign	Het
Cacna1c	A	T	6: 118,630,270	C1224*	probably null	Het
Cpsf2	C	T	12: 101,997,242		probably benign	Het
Cyp11b2	G	A	15: 74,853,641	R210W	probably damaging	Het
Dock7	C	T	4: 98,989,258	V1048I	probably benign	Het
Dync2h1	C	A	9: 7,077,979	A2908S	probably benign	Het
Elane	A	G	10: 79,887,108	D116G	probably damaging	Het
Epb41l2	C	T	10: 25,507,816	R153C	probably damaging	Het
Gucy2c	G	A	6: 136,722,420	P617L	probably damaging	Het
Hist2h2ab	G	A	3: 96,220,123	A70T	probably damaging	Het
Kcnq4	T	A	4: 120,746,861	I106L	probably benign	Het
Man2b1	A	G	8: 85,096,829	N931D	possibly damaging	Het
Mthfs	A	G	9: 89,215,390	E100G	probably damaging	Het
Mto1	A	T	9: 78,473,790	I639F	probably damaging	Het
Myo15	A	G	11: 60,487,251	E177G	probably damaging	Het
Naip5	T	A	13: 100,230,743	M282L	probably benign	Het
Olfr433	A	G	1: 174,042,487	D179G	probably damaging	Het
Pik3c2g	G	A	6: 139,957,699		probably benign	Het
Prl7d1	T	A	13: 27,714,338	M64L	probably benign	Het
Prnp	A	T	2: 131,936,524	N32I	probably damaging	Het
Ptpn11	C	T	5: 121,149,111	V406I	probably benign	Het
Rab40c	G	A	17: 25,884,693	T151I	probably damaging	Het
Rb1cc1	T	A	1: 6,234,271		probably null	Het
Rnf145	T	C	11: 44,524,988	V10A	probably benign	Het
Rtn4rl2	T	C	2: 84,880,692	N70S	probably damaging	Het
Scaper	A	T	9: 55,859,042	C483*	probably null	Het
Sema4a	T	A	3: 88,453,098	Q58L	possibly damaging	Het
Slf1	T	C	13: 77,100,948		probably null	Het
Sycp1	G	T	3: 102,915,245	N364K	probably benign	Het
Tenm4	T	C	7: 96,896,275		probably benign	Het
Tnfaip2	A	G	12: 111,450,707	T537A	probably damaging	Het
Trappc12	A	G	12: 28,703,597	I573T	possibly damaging	Het
Ulk1	A	T	5: 110,789,545		probably benign	Het
Unc80	G	A	1: 66,648,944	C2367Y	possibly damaging	Het
Usp7	C	A	16: 8,703,502	G135C	probably damaging	Het
Vmn2r103	A	G	17: 19,793,927	Y327C	probably damaging	Het
Vmn2r28	T	A	7: 5,488,027	H407L	probably damaging	Het
Zfp804a	A	C	2: 82,259,162	T1112P	probably damaging	Het
Zfr2	A	G	10: 81,245,408	K431E	probably damaging	Het
Zfy1	A	T	Y: 725,850	Y638*	probably null	Het

Other mutations in Ugt2b38

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00959:Ugt2b38	APN	5	87411823	missense	probably damaging	1.00
IGL02326:Ugt2b38	APN	5	87423733	missense	probably damaging	1.00
IGL02537:Ugt2b38	APN	5	87421731	missense	possibly damaging	0.91
IGL02543:Ugt2b38	APN	5	87423483	missense	probably benign	0.00
IGL02852:Ugt2b38	APN	5	87411741	missense	probably benign
IGL03008:Ugt2b38	APN	5	87412423	missense	probably benign	0.00
over_easy	UTSW	5	87423742	missense	probably benign	0.25
R0089:Ugt2b38	UTSW	5	87420558	missense	probably benign	0.00
R0647:Ugt2b38	UTSW	5	87423469	missense	probably benign	0.00
R0731:Ugt2b38	UTSW	5	87420452	missense	probably damaging	1.00
R0966:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R0969:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R0970:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R0971:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1068:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1070:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1071:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1073:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1133:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1134:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1367:Ugt2b38	UTSW	5	87424114	missense	probably benign	0.11
R1383:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1467:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1467:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1565:Ugt2b38	UTSW	5	87411914	missense	probably damaging	0.99
R1691:Ugt2b38	UTSW	5	87424132	missense	probably benign
R1725:Ugt2b38	UTSW	5	87411871	missense	probably damaging	1.00
R1736:Ugt2b38	UTSW	5	87423633	missense	probably benign
R2230:Ugt2b38	UTSW	5	87421668	missense	probably benign	0.05
R2419:Ugt2b38	UTSW	5	87423732	missense	probably damaging	1.00
R2496:Ugt2b38	UTSW	5	87421692	missense	probably damaging	1.00
R3196:Ugt2b38	UTSW	5	87410219	missense	probably damaging	0.96
R3773:Ugt2b38	UTSW	5	87424095	missense	probably damaging	0.99
R5125:Ugt2b38	UTSW	5	87411812	missense	probably damaging	1.00
R5224:Ugt2b38	UTSW	5	87423742	missense	probably benign	0.25
R5516:Ugt2b38	UTSW	5	87411843	missense	probably damaging	1.00
R5765:Ugt2b38	UTSW	5	87424095	missense	probably damaging	0.99
R6352:Ugt2b38	UTSW	5	87424001	missense	possibly damaging	0.73
R7166:Ugt2b38	UTSW	5	87410446	missense	probably damaging	1.00
R7210:Ugt2b38	UTSW	5	87410425	missense	probably damaging	0.99
R7291:Ugt2b38	UTSW	5	87411895	missense	probably damaging	1.00
R7483:Ugt2b38	UTSW	5	87424114	missense	probably damaging	0.96
R7969:Ugt2b38	UTSW	5	87424032	missense	probably benign	0.02
R8118:Ugt2b38	UTSW	5	87423771	missense	probably damaging	1.00
R8239:Ugt2b38	UTSW	5	87423800	missense	probably benign	0.02
R8676:Ugt2b38	UTSW	5	87411822	missense	probably benign	0.12
R9178:Ugt2b38	UTSW	5	87420537	missense	probably damaging	1.00
R9193:Ugt2b38	UTSW	5	87423870	missense	probably benign	0.05
R9566:Ugt2b38	UTSW	5	87410350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTTCTTTTGAAGTGTTGGACAGGAC -3'
(R):5'- AAGCCTTTGTAACTCATGGTGGGG -3'

Sequencing Primer
(F):5'- CAGGACTATCAAGATCATTCTTGGC -3'
(R):5'- TAACTCATGGTGGGGCCAATG -3'

Posted On

2013-10-16