Incidental Mutation 'R0837:Bicdl1'
ID77987
Institutional Source Beutler Lab
Gene Symbol Bicdl1
Ensembl Gene ENSMUSG00000041609
Gene NameBICD family like cargo adaptor 1
Synonyms2210403N09Rik, Ccdc64, BICDR-1
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.640) question?
Stock #R0837 (G1)
Quality Score212
Status Validated
Chromosome5
Chromosomal Location115648175-115731621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115731292 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 26 (P26S)
Ref Sequence ENSEMBL: ENSMUSP00000119015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055408] [ENSMUST00000141950]
Predicted Effect probably benign
Transcript: ENSMUST00000055408
AA Change: P90S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000053547
Gene: ENSMUSG00000041609
AA Change: P90S

DomainStartEndE-ValueType
low complexity region 47 68 N/A INTRINSIC
Pfam:HAP1_N 97 162 2e-11 PFAM
low complexity region 305 316 N/A INTRINSIC
low complexity region 336 374 N/A INTRINSIC
low complexity region 389 410 N/A INTRINSIC
coiled coil region 467 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141950
AA Change: P26S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000119015
Gene: ENSMUSG00000041609
AA Change: P26S

DomainStartEndE-ValueType
Pfam:HAP1_N 35 99 4.5e-11 PFAM
coiled coil region 192 236 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148840
Meta Mutation Damage Score 0.0641 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Bicdl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Bicdl1 APN 5 115670156 nonsense probably null
IGL01902:Bicdl1 APN 5 115651874 missense probably damaging 1.00
IGL02416:Bicdl1 APN 5 115663885 missense probably damaging 1.00
IGL02417:Bicdl1 APN 5 115673158 missense probably damaging 1.00
IGL03088:Bicdl1 APN 5 115663822 missense possibly damaging 0.83
IGL03275:Bicdl1 APN 5 115731160 missense probably damaging 1.00
bargain UTSW 5 115670153 critical splice donor site probably null
R6807_Bicdl1_588 UTSW 5 115672143 critical splice donor site probably null
R0924:Bicdl1 UTSW 5 115661528 splice site probably benign
R1581:Bicdl1 UTSW 5 115651267 unclassified probably benign
R1589:Bicdl1 UTSW 5 115651266 unclassified probably benign
R1669:Bicdl1 UTSW 5 115656016 missense possibly damaging 0.84
R2076:Bicdl1 UTSW 5 115655928 missense probably damaging 0.96
R2089:Bicdl1 UTSW 5 115724579 missense probably damaging 1.00
R2091:Bicdl1 UTSW 5 115724579 missense probably damaging 1.00
R2091:Bicdl1 UTSW 5 115724579 missense probably damaging 1.00
R4772:Bicdl1 UTSW 5 115661478 missense probably benign 0.36
R6185:Bicdl1 UTSW 5 115670153 critical splice donor site probably null
R6807:Bicdl1 UTSW 5 115672143 critical splice donor site probably null
R7107:Bicdl1 UTSW 5 115670170 missense probably benign 0.03
R7157:Bicdl1 UTSW 5 115651857 missense possibly damaging 0.92
R7205:Bicdl1 UTSW 5 115670281 missense probably damaging 1.00
R7485:Bicdl1 UTSW 5 115663786 nonsense probably null
R7781:Bicdl1 UTSW 5 115661487 missense probably damaging 1.00
R8816:Bicdl1 UTSW 5 115724745 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGAGGTAGACTAGGCACGGAAAC -3'
(R):5'- ACAGCGCCTGCTGCATGGAG -3'

Sequencing Primer
(F):5'- GAAGGTCCTCACCTCTAGCTTG -3'
(R):5'- TGCTGCATGGAGCTGCC -3'
Posted On2013-10-16