Incidental Mutation 'R0837:Ptpn11'
ID77988
Institutional Source Beutler Lab
Gene Symbol Ptpn11
Ensembl Gene ENSMUSG00000043733
Gene Nameprotein tyrosine phosphatase, non-receptor type 11
SynonymsSHP-2, SH2 domain-containing protein tyrosine phosphatase-2, Syp, 2700084A17Rik, SH-PTP2, Shp2, PTP2C, PTP1D
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0837 (G1)
Quality Score223
Status Validated
Chromosome5
Chromosomal Location121130533-121191397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121149111 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 406 (V406I)
Ref Sequence ENSEMBL: ENSMUSP00000098333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054547] [ENSMUST00000100770]
Predicted Effect probably benign
Transcript: ENSMUST00000054547
AA Change: V406I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058757
Gene: ENSMUSG00000043733
AA Change: V406I

DomainStartEndE-ValueType
SH2 4 87 8.34e-30 SMART
SH2 110 203 9.65e-35 SMART
PTPc 246 527 7.22e-133 SMART
low complexity region 563 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100770
AA Change: V406I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098333
Gene: ENSMUSG00000043733
AA Change: V406I

DomainStartEndE-ValueType
SH2 4 87 8.34e-30 SMART
SH2 110 203 9.65e-35 SMART
PTPc 246 523 5.19e-134 SMART
low complexity region 559 569 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148407
Meta Mutation Damage Score 0.0681 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains two tandem Src homology-2 domains, which function as phospho-tyrosine binding domains and mediate the interaction of this PTP with its substrates. This PTP is widely expressed in most tissues and plays a regulatory role in various cell signaling events that are important for a diversity of cell functions, such as mitogenic activation, metabolic control, transcription regulation, and cell migration. Mutations in this gene are a cause of Noonan syndrome as well as acute myeloid leukemia. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mutants exhibit abnormal mesoderm patterning leading to a failure of gastrulation and death by embryonic day 10.5. In heterozygous state the null mutant acts as a dominant enhancer of a mild epidermal growth factor receptor mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Ptpn11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Ptpn11 APN 5 121143136 missense probably damaging 1.00
IGL03132:Ptpn11 APN 5 121134815 missense possibly damaging 0.94
noon UTSW 5 121144653 missense probably damaging 1.00
PIT4515001:Ptpn11 UTSW 5 121164554 missense probably damaging 0.96
R1544:Ptpn11 UTSW 5 121137511 missense probably benign 0.04
R2131:Ptpn11 UTSW 5 121172026 missense probably damaging 0.99
R4124:Ptpn11 UTSW 5 121137457 missense probably benign 0.00
R6082:Ptpn11 UTSW 5 121154526 missense probably benign
R6331:Ptpn11 UTSW 5 121144653 missense probably damaging 1.00
R6628:Ptpn11 UTSW 5 121134829 splice site probably null
R7077:Ptpn11 UTSW 5 121143570 missense probably benign 0.12
R7396:Ptpn11 UTSW 5 121144644 missense probably benign 0.04
R8682:Ptpn11 UTSW 5 121167990 missense possibly damaging 0.94
Z1176:Ptpn11 UTSW 5 121143094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAACTCAGCAAGTGTCACC -3'
(R):5'- CTGGATTTTCACTAGGGCTTGGGAC -3'

Sequencing Primer
(F):5'- gaggcagaggcaggtgg -3'
(R):5'- ATGCGCTCAAAGAATACGGG -3'
Posted On2013-10-16