Incidental Mutation 'R0837:Gucy2c'
ID77990
Institutional Source Beutler Lab
Gene Symbol Gucy2c
Ensembl Gene ENSMUSG00000042638
Gene Nameguanylate cyclase 2c
SynonymsGC-C
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0837 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location136697284-136781765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 136722420 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 617 (P617L)
Ref Sequence ENSEMBL: ENSMUSP00000077236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032338] [ENSMUST00000078095]
Predicted Effect probably damaging
Transcript: ENSMUST00000032338
AA Change: P641L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032338
Gene: ENSMUSG00000042638
AA Change: P641L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 113 384 3.7e-8 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Pfam:Pkinase_Tyr 498 744 3.4e-33 PFAM
Pfam:Pkinase 499 744 1e-26 PFAM
CYCc 787 982 2.68e-107 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078095
AA Change: P617L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077236
Gene: ENSMUSG00000042638
AA Change: P617L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 53 385 2.7e-41 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Pfam:Pkinase_Tyr 475 720 6.5e-32 PFAM
Pfam:Pkinase 480 720 7.2e-25 PFAM
CYCc 763 958 2.68e-107 SMART
Meta Mutation Damage Score 0.3591 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions as a receptor for endogenous peptides guanylin and uroguanylin, and the heat-stable E. coli enterotoxin. The encoded protein activates the cystic fibrosis transmembrane conductance regulator. Mutations in this gene are associated with familial diarrhea (autosomal dominant) and meconium ileus (autosomal recessive). [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous null mice are viable and have an increased resistance to heat-stable enterotoxins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Gucy2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Gucy2c APN 6 136765614 missense probably benign 0.01
IGL01081:Gucy2c APN 6 136702739 missense probably damaging 1.00
IGL01285:Gucy2c APN 6 136709741 missense probably damaging 1.00
IGL01395:Gucy2c APN 6 136698029 missense probably damaging 1.00
IGL01408:Gucy2c APN 6 136698011 missense probably benign 0.19
IGL01752:Gucy2c APN 6 136770108 missense probably benign 0.10
IGL01766:Gucy2c APN 6 136715973 missense probably benign 0.43
IGL02245:Gucy2c APN 6 136729203 missense probably benign 0.00
IGL02648:Gucy2c APN 6 136729213 nonsense probably null
IGL02794:Gucy2c APN 6 136713148 missense probably damaging 1.00
IGL03023:Gucy2c APN 6 136702796 splice site probably null
IGL03178:Gucy2c APN 6 136729239 splice site probably benign
IGL03310:Gucy2c APN 6 136751046 missense probably benign
IGL03374:Gucy2c APN 6 136765630 missense probably benign 0.00
IGL03393:Gucy2c APN 6 136719667 missense probably benign 0.04
BB001:Gucy2c UTSW 6 136763055 missense probably benign 0.35
BB011:Gucy2c UTSW 6 136763055 missense probably benign 0.35
R0031:Gucy2c UTSW 6 136697999 missense probably damaging 0.99
R0128:Gucy2c UTSW 6 136704249 missense probably damaging 1.00
R0377:Gucy2c UTSW 6 136750917 critical splice donor site probably null
R0593:Gucy2c UTSW 6 136728335 missense probably damaging 0.99
R0613:Gucy2c UTSW 6 136760723 missense probably damaging 1.00
R0723:Gucy2c UTSW 6 136727801 splice site probably null
R0828:Gucy2c UTSW 6 136709748 missense probably damaging 1.00
R0880:Gucy2c UTSW 6 136709832 critical splice acceptor site probably null
R1350:Gucy2c UTSW 6 136743914 critical splice donor site probably null
R1487:Gucy2c UTSW 6 136748826 missense possibly damaging 0.79
R1680:Gucy2c UTSW 6 136722493 missense probably damaging 1.00
R1751:Gucy2c UTSW 6 136748775 splice site probably benign
R1791:Gucy2c UTSW 6 136744027 missense probably damaging 1.00
R1953:Gucy2c UTSW 6 136704293 missense probably damaging 1.00
R2135:Gucy2c UTSW 6 136723728 missense probably damaging 1.00
R2227:Gucy2c UTSW 6 136702760 missense probably damaging 1.00
R2350:Gucy2c UTSW 6 136763074 missense probably damaging 0.98
R2906:Gucy2c UTSW 6 136708387 missense probably damaging 1.00
R2907:Gucy2c UTSW 6 136708387 missense probably damaging 1.00
R3699:Gucy2c UTSW 6 136770111 missense probably damaging 1.00
R3972:Gucy2c UTSW 6 136708366 missense probably damaging 1.00
R4613:Gucy2c UTSW 6 136708321 missense probably damaging 1.00
R4732:Gucy2c UTSW 6 136767152 missense probably damaging 1.00
R4733:Gucy2c UTSW 6 136767152 missense probably damaging 1.00
R4776:Gucy2c UTSW 6 136722514 missense probably damaging 1.00
R5087:Gucy2c UTSW 6 136767035 missense possibly damaging 0.69
R5284:Gucy2c UTSW 6 136763043 missense possibly damaging 0.56
R5366:Gucy2c UTSW 6 136720741 missense probably damaging 0.99
R5466:Gucy2c UTSW 6 136781465 nonsense probably null
R5911:Gucy2c UTSW 6 136722442 missense probably damaging 1.00
R6160:Gucy2c UTSW 6 136740686 nonsense probably null
R6367:Gucy2c UTSW 6 136709778 missense probably damaging 1.00
R6441:Gucy2c UTSW 6 136723761 missense probably damaging 0.98
R6812:Gucy2c UTSW 6 136697995 missense probably benign
R6865:Gucy2c UTSW 6 136770129 missense probably benign 0.13
R7065:Gucy2c UTSW 6 136720766 missense probably damaging 1.00
R7078:Gucy2c UTSW 6 136697939 missense probably benign 0.19
R7096:Gucy2c UTSW 6 136728341 missense probably benign 0.11
R7138:Gucy2c UTSW 6 136728344 missense probably damaging 1.00
R7343:Gucy2c UTSW 6 136702748 missense probably damaging 1.00
R7538:Gucy2c UTSW 6 136709744 missense probably damaging 1.00
R7587:Gucy2c UTSW 6 136704290 missense probably damaging 1.00
R7666:Gucy2c UTSW 6 136697968 missense probably benign
R7675:Gucy2c UTSW 6 136716032 missense possibly damaging 0.91
R7822:Gucy2c UTSW 6 136708406 missense probably damaging 1.00
R7842:Gucy2c UTSW 6 136769816 splice site probably null
R7924:Gucy2c UTSW 6 136763055 missense probably benign 0.35
R8078:Gucy2c UTSW 6 136697921 missense probably damaging 1.00
R8094:Gucy2c UTSW 6 136737448 missense probably benign 0.33
R8391:Gucy2c UTSW 6 136704215 missense probably damaging 1.00
R8428:Gucy2c UTSW 6 136727894 missense probably damaging 0.96
Z1088:Gucy2c UTSW 6 136743981 missense probably benign
Z1177:Gucy2c UTSW 6 136719687 missense probably damaging 1.00
Z1177:Gucy2c UTSW 6 136767196 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGAGCCGAATACCGAAAACAGTG -3'
(R):5'- AATTGGACAGTACGGCCACACG -3'

Sequencing Primer
(F):5'- gcctgatgccctcttctg -3'
(R):5'- GTCACTCAGCCAAAGTTTGTG -3'
Posted On2013-10-16