Mutagenetix > Incidental Mutation

Incidental Mutation 'R0837:Man2b1'

77995

Institutional Source

Beutler Lab

Gene Symbol

Man2b1

Ensembl Gene

ENSMUSG00000005142

Gene Name

mannosidase 2, alpha B1

Synonyms

lysosomal alpha-mannosidase

MMRRC Submission

039016-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0837 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85083270-85098282 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85096829 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 931 (N931D)

Ref Sequence

ENSEMBL: ENSMUSP00000034121 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034121]

AlphaFold

O09159

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034121
AA Change: N931D

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142
AA Change: N931D

Domain	Start	End	E-Value	Type
low complexity region	40	51	N/A	INTRINSIC
Pfam:Glyco_hydro_38	64	381	2.7e-96	PFAM
Alpha-mann_mid	386	465	4.25e-23	SMART
Pfam:Glyco_hydro_38C	510	1002	6.2e-106	PFAM

Meta Mutation Damage Score

0.1537

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.8%

Validation Efficiency

96% (44/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes terminal, non-reducing alpha-D-mannose residues in alpha-D-mannosides. Its activity is necessary for the catabolism of N-linked carbohydrates released during glycoprotein turnover and it is member of family 38 of glycosyl hydrolases. The full length protein is processed in two steps. First, a 49 aa leader sequence is cleaved off and the remainder of the protein is processed into 3 peptides of 70 kDa, 42 kDa (D) and 13/15 kDa (E). Next, the 70 kDa peptide is further processed into three peptides (A, B and C). The A, B and C peptides are disulfide-linked. Defects in this gene have been associated with lysosomal alpha-mannosidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show urinary oligosaccharide excretion, storage of neutral sugars, oligosaccharide buildup in spleen, kidney, liver, testis and brain, clear vacuoles and axonal spheroids in CNS, PNS and other cell types, behavioralchanges, and enhanced long-term potentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563I02Rik	T	C	14: 60,095,926		probably benign	Het
4930579C12Rik	A	G	9: 89,168,207		noncoding transcript	Het
Adam34	T	A	8: 43,651,500	K369N	probably benign	Het
Ap1g1	T	C	8: 109,851,065	W481R	probably damaging	Het
Bicdl1	G	A	5: 115,731,292	P26S	probably benign	Het
Cacna1c	A	T	6: 118,630,270	C1224*	probably null	Het
Cpsf2	C	T	12: 101,997,242		probably benign	Het
Cyp11b2	G	A	15: 74,853,641	R210W	probably damaging	Het
Dock7	C	T	4: 98,989,258	V1048I	probably benign	Het
Dync2h1	C	A	9: 7,077,979	A2908S	probably benign	Het
Elane	A	G	10: 79,887,108	D116G	probably damaging	Het
Epb41l2	C	T	10: 25,507,816	R153C	probably damaging	Het
Gucy2c	G	A	6: 136,722,420	P617L	probably damaging	Het
Hist2h2ab	G	A	3: 96,220,123	A70T	probably damaging	Het
Kcnq4	T	A	4: 120,746,861	I106L	probably benign	Het
Mthfs	A	G	9: 89,215,390	E100G	probably damaging	Het
Mto1	A	T	9: 78,473,790	I639F	probably damaging	Het
Myo15	A	G	11: 60,487,251	E177G	probably damaging	Het
Naip5	T	A	13: 100,230,743	M282L	probably benign	Het
Olfr433	A	G	1: 174,042,487	D179G	probably damaging	Het
Pik3c2g	G	A	6: 139,957,699		probably benign	Het
Prl7d1	T	A	13: 27,714,338	M64L	probably benign	Het
Prnp	A	T	2: 131,936,524	N32I	probably damaging	Het
Ptpn11	C	T	5: 121,149,111	V406I	probably benign	Het
Rab40c	G	A	17: 25,884,693	T151I	probably damaging	Het
Rb1cc1	T	A	1: 6,234,271		probably null	Het
Rnf145	T	C	11: 44,524,988	V10A	probably benign	Het
Rtn4rl2	T	C	2: 84,880,692	N70S	probably damaging	Het
Scaper	A	T	9: 55,859,042	C483*	probably null	Het
Sema4a	T	A	3: 88,453,098	Q58L	possibly damaging	Het
Slf1	T	C	13: 77,100,948		probably null	Het
Sycp1	G	T	3: 102,915,245	N364K	probably benign	Het
Tenm4	T	C	7: 96,896,275		probably benign	Het
Tnfaip2	A	G	12: 111,450,707	T537A	probably damaging	Het
Trappc12	A	G	12: 28,703,597	I573T	possibly damaging	Het
Ugt2b38	G	A	5: 87,411,773	T420I	probably damaging	Het
Ulk1	A	T	5: 110,789,545		probably benign	Het
Unc80	G	A	1: 66,648,944	C2367Y	possibly damaging	Het
Usp7	C	A	16: 8,703,502	G135C	probably damaging	Het
Vmn2r103	A	G	17: 19,793,927	Y327C	probably damaging	Het
Vmn2r28	T	A	7: 5,488,027	H407L	probably damaging	Het
Zfp804a	A	C	2: 82,259,162	T1112P	probably damaging	Het
Zfr2	A	G	10: 81,245,408	K431E	probably damaging	Het
Zfy1	A	T	Y: 725,850	Y638*	probably null	Het

Other mutations in Man2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00588:Man2b1	APN	8	85084638	splice site	probably null
IGL00671:Man2b1	APN	8	85093938	missense	probably damaging	0.98
IGL01538:Man2b1	APN	8	85097430	missense	probably benign	0.00
dateline	UTSW	8	85084737	missense	probably damaging	1.00
greenwich	UTSW	8	85085456	nonsense	probably null
longitude	UTSW	8	85095144	nonsense	probably null
meridian	UTSW	8	85096752	missense	probably damaging	1.00
R0018:Man2b1	UTSW	8	85097489	missense	probably damaging	1.00
R0302:Man2b1	UTSW	8	85093016	missense	probably damaging	1.00
R0574:Man2b1	UTSW	8	85096776	missense	probably benign
R0727:Man2b1	UTSW	8	85091526	missense	probably damaging	1.00
R1087:Man2b1	UTSW	8	85095171	missense	probably damaging	1.00
R1471:Man2b1	UTSW	8	85086845	missense	probably damaging	0.99
R1745:Man2b1	UTSW	8	85093934	missense	probably damaging	1.00
R1903:Man2b1	UTSW	8	85086822	missense	probably damaging	1.00
R2026:Man2b1	UTSW	8	85095335	missense	probably damaging	0.99
R2071:Man2b1	UTSW	8	85085384	missense	possibly damaging	0.90
R2120:Man2b1	UTSW	8	85093024	splice site	probably benign
R3897:Man2b1	UTSW	8	85096948	splice site	probably benign
R3971:Man2b1	UTSW	8	85085391	missense	probably damaging	0.98
R3972:Man2b1	UTSW	8	85085391	missense	probably damaging	0.98
R4096:Man2b1	UTSW	8	85084737	missense	probably damaging	1.00
R4497:Man2b1	UTSW	8	85090936	missense	probably benign	0.22
R5183:Man2b1	UTSW	8	85095784	missense	probably damaging	1.00
R5191:Man2b1	UTSW	8	85084459	missense	probably damaging	1.00
R5644:Man2b1	UTSW	8	85094210	missense	possibly damaging	0.61
R6027:Man2b1	UTSW	8	85096752	missense	probably damaging	1.00
R6291:Man2b1	UTSW	8	85097046	missense	probably benign	0.44
R6341:Man2b1	UTSW	8	85095399	missense	probably damaging	1.00
R6467:Man2b1	UTSW	8	85097447	missense	possibly damaging	0.91
R6622:Man2b1	UTSW	8	85084479	missense	probably damaging	1.00
R6624:Man2b1	UTSW	8	85096853	missense	probably benign	0.01
R6631:Man2b1	UTSW	8	85086811	splice site	probably null
R6828:Man2b1	UTSW	8	85086919	missense	possibly damaging	0.88
R6983:Man2b1	UTSW	8	85091071	splice site	probably null
R7159:Man2b1	UTSW	8	85087280	missense	probably benign	0.09
R7267:Man2b1	UTSW	8	85087175	missense	probably damaging	1.00
R7537:Man2b1	UTSW	8	85090965	nonsense	probably null
R7786:Man2b1	UTSW	8	85085456	nonsense	probably null
R8022:Man2b1	UTSW	8	85095613	missense	probably damaging	1.00
R8069:Man2b1	UTSW	8	85097045	missense	probably benign	0.03
R8251:Man2b1	UTSW	8	85095129	missense	probably damaging	0.99
R8406:Man2b1	UTSW	8	85096278	missense	probably damaging	1.00
R8464:Man2b1	UTSW	8	85094143	missense	possibly damaging	0.55
R8701:Man2b1	UTSW	8	85095153	missense	probably damaging	1.00
R8792:Man2b1	UTSW	8	85095144	nonsense	probably null
R8891:Man2b1	UTSW	8	85084455	missense	probably damaging	1.00
R8930:Man2b1	UTSW	8	85095393	missense	probably damaging	1.00
R8932:Man2b1	UTSW	8	85095393	missense	probably damaging	1.00
R8953:Man2b1	UTSW	8	85091910	missense	probably benign	0.36
R9059:Man2b1	UTSW	8	85091526	missense	probably damaging	1.00
Z1176:Man2b1	UTSW	8	85093938	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TAAGAAACAGCTTCCGTCCGCCTC -3'
(R):5'- GCACTGCTCACTGTAAACCTCTGTC -3'

Sequencing Primer
(F):5'- GAAGCCCCTTCCCATTATGC -3'
(R):5'- TCATCCACTTGAGCCTGGAAG -3'

Posted On

2013-10-16