Incidental Mutation 'R0837:Mto1'
ID77999
Institutional Source Beutler Lab
Gene Symbol Mto1
Ensembl Gene ENSMUSG00000032342
Gene Namemitochondrial tRNA translation optimization 1
Synonyms5730419A02Rik, 2310039H01Rik
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R0837 (G1)
Quality Score187
Status Validated
Chromosome9
Chromosomal Location78448208-78475348 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78473790 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 639 (I639F)
Ref Sequence ENSEMBL: ENSMUSP00000034896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034896] [ENSMUST00000042235] [ENSMUST00000148238]
Predicted Effect probably damaging
Transcript: ENSMUST00000034896
AA Change: I639F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034896
Gene: ENSMUSG00000032342
AA Change: I639F

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
Pfam:FAD_binding_2 37 84 1.3e-6 PFAM
Pfam:FAD_oxidored 37 194 2.3e-9 PFAM
Pfam:GIDA 37 435 3.5e-153 PFAM
low complexity region 518 529 N/A INTRINSIC
GIDA_assoc_3 585 658 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042235
SMART Domains Protein: ENSMUSP00000042457
Gene: ENSMUSG00000037742

DomainStartEndE-ValueType
Pfam:GTP_EFTU 5 238 3.4e-55 PFAM
Pfam:GTP_EFTU_D2 260 327 6.3e-16 PFAM
Pfam:GTP_EFTU_D3 333 442 5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129380
Predicted Effect unknown
Transcript: ENSMUST00000133002
AA Change: I58F
SMART Domains Protein: ENSMUSP00000123414
Gene: ENSMUSG00000032342
AA Change: I58F

DomainStartEndE-ValueType
GIDA_assoc_3 5 78 8.31e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136478
Predicted Effect probably benign
Transcript: ENSMUST00000148238
SMART Domains Protein: ENSMUSP00000121424
Gene: ENSMUSG00000032342

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
Pfam:FAD_binding_2 37 84 7.1e-7 PFAM
Pfam:Pyr_redox_2 37 156 2.1e-7 PFAM
Pfam:FAD_oxidored 37 178 1.1e-9 PFAM
Pfam:GIDA 37 184 8.5e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157051
Meta Mutation Damage Score 0.5378 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein thought to be involved in mitochondrial tRNA modification. The encoded protein may also play a role in the expression of the non-syndromic and aminoglycoside-induced deafness phenotypes associated with a specific mutation in the mitochondrial 12S rRNA gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a hypomorphic allele show bradycardia, cardiomyopathy, worsening of arrhythmias during induction and reversal of anesthesia, and mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Mto1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Mto1 APN 9 78461643 missense probably benign 0.00
IGL01362:Mto1 APN 9 78452774 missense probably benign 0.00
IGL01906:Mto1 APN 9 78464931 missense probably benign
IGL02499:Mto1 APN 9 78461512 splice site probably benign
IGL02504:Mto1 APN 9 78460927 missense probably damaging 1.00
IGL03104:Mto1 APN 9 78449520 missense probably damaging 1.00
PIT4515001:Mto1 UTSW 9 78457417 missense probably damaging 1.00
R0089:Mto1 UTSW 9 78473872 missense probably benign
R0325:Mto1 UTSW 9 78453004 missense probably damaging 1.00
R0566:Mto1 UTSW 9 78448301 missense possibly damaging 0.66
R0659:Mto1 UTSW 9 78457508 missense probably damaging 1.00
R0659:Mto1 UTSW 9 78470790 missense probably damaging 1.00
R1679:Mto1 UTSW 9 78464963 missense probably benign
R1899:Mto1 UTSW 9 78461517 splice site probably benign
R1900:Mto1 UTSW 9 78461517 splice site probably benign
R2235:Mto1 UTSW 9 78457564 missense possibly damaging 0.58
R3078:Mto1 UTSW 9 78458028 missense probably damaging 1.00
R5015:Mto1 UTSW 9 78461621 missense probably benign 0.25
R5420:Mto1 UTSW 9 78452827 missense probably benign
R5947:Mto1 UTSW 9 78461029 missense probably damaging 1.00
R5969:Mto1 UTSW 9 78452905 missense probably damaging 1.00
R6092:Mto1 UTSW 9 78460849 missense possibly damaging 0.95
R6336:Mto1 UTSW 9 78473835 missense probably damaging 0.98
R6542:Mto1 UTSW 9 78457228 missense possibly damaging 0.94
R7092:Mto1 UTSW 9 78470673 missense probably benign 0.25
R7150:Mto1 UTSW 9 78457283 missense probably damaging 1.00
R7852:Mto1 UTSW 9 78449538 missense possibly damaging 0.82
R8922:Mto1 UTSW 9 78470646 missense not run
RF014:Mto1 UTSW 9 78448316 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTGTTTTGTTGAGACATGGTTTCCCAC -3'
(R):5'- GCCCTAAGCCCTCACTCTAAGTCC -3'

Sequencing Primer
(F):5'- gtgggagactgaaatgaggg -3'
(R):5'- CCTCACTCTAAGTCCTCTATGAAATG -3'
Posted On2013-10-16