Incidental Mutation 'R0837:Mto1'
ID 77999
Institutional Source Beutler Lab
Gene Symbol Mto1
Ensembl Gene ENSMUSG00000032342
Gene Name mitochondrial tRNA translation optimization 1
Synonyms 5730419A02Rik, 2310039H01Rik
MMRRC Submission 039016-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R0837 (G1)
Quality Score 187
Status Validated
Chromosome 9
Chromosomal Location 78355372-78381447 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 78381072 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 639 (I639F)
Ref Sequence ENSEMBL: ENSMUSP00000034896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034896] [ENSMUST00000042235] [ENSMUST00000148238]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000034896
AA Change: I639F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034896
Gene: ENSMUSG00000032342
AA Change: I639F

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
Pfam:FAD_binding_2 37 84 1.3e-6 PFAM
Pfam:FAD_oxidored 37 194 2.3e-9 PFAM
Pfam:GIDA 37 435 3.5e-153 PFAM
low complexity region 518 529 N/A INTRINSIC
GIDA_assoc_3 585 658 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042235
SMART Domains Protein: ENSMUSP00000042457
Gene: ENSMUSG00000037742

DomainStartEndE-ValueType
Pfam:GTP_EFTU 5 238 3.4e-55 PFAM
Pfam:GTP_EFTU_D2 260 327 6.3e-16 PFAM
Pfam:GTP_EFTU_D3 333 442 5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129380
Predicted Effect unknown
Transcript: ENSMUST00000133002
AA Change: I58F
SMART Domains Protein: ENSMUSP00000123414
Gene: ENSMUSG00000032342
AA Change: I58F

DomainStartEndE-ValueType
GIDA_assoc_3 5 78 8.31e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136478
Predicted Effect probably benign
Transcript: ENSMUST00000148238
SMART Domains Protein: ENSMUSP00000121424
Gene: ENSMUSG00000032342

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
Pfam:FAD_binding_2 37 84 7.1e-7 PFAM
Pfam:Pyr_redox_2 37 156 2.1e-7 PFAM
Pfam:FAD_oxidored 37 178 1.1e-9 PFAM
Pfam:GIDA 37 184 8.5e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157051
Meta Mutation Damage Score 0.5378 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein thought to be involved in mitochondrial tRNA modification. The encoded protein may also play a role in the expression of the non-syndromic and aminoglycoside-induced deafness phenotypes associated with a specific mutation in the mitochondrial 12S rRNA gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a hypomorphic allele show bradycardia, cardiomyopathy, worsening of arrhythmias during induction and reversal of anesthesia, and mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,333,375 (GRCm39) probably benign Het
4930579C12Rik A G 9: 89,050,260 (GRCm39) noncoding transcript Het
Adam34 T A 8: 44,104,537 (GRCm39) K369N probably benign Het
Ap1g1 T C 8: 110,577,697 (GRCm39) W481R probably damaging Het
Bicdl1 G A 5: 115,869,351 (GRCm39) P26S probably benign Het
Cacna1c A T 6: 118,607,231 (GRCm39) C1224* probably null Het
Cpsf2 C T 12: 101,963,501 (GRCm39) probably benign Het
Cyp11b2 G A 15: 74,725,490 (GRCm39) R210W probably damaging Het
Dock7 C T 4: 98,877,495 (GRCm39) V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 (GRCm39) A2908S probably benign Het
Elane A G 10: 79,722,942 (GRCm39) D116G probably damaging Het
Epb41l2 C T 10: 25,383,714 (GRCm39) R153C probably damaging Het
Gucy2c G A 6: 136,699,418 (GRCm39) P617L probably damaging Het
H2ac21 G A 3: 96,127,439 (GRCm39) A70T probably damaging Het
Kcnq4 T A 4: 120,604,058 (GRCm39) I106L probably benign Het
Man2b1 A G 8: 85,823,458 (GRCm39) N931D possibly damaging Het
Mthfs A G 9: 89,097,443 (GRCm39) E100G probably damaging Het
Myo15a A G 11: 60,378,077 (GRCm39) E177G probably damaging Het
Naip5 T A 13: 100,367,251 (GRCm39) M282L probably benign Het
Or10aa1 A G 1: 173,870,053 (GRCm39) D179G probably damaging Het
Pik3c2g G A 6: 139,903,425 (GRCm39) probably benign Het
Prl7d1 T A 13: 27,898,321 (GRCm39) M64L probably benign Het
Prnp A T 2: 131,778,444 (GRCm39) N32I probably damaging Het
Ptpn11 C T 5: 121,287,174 (GRCm39) V406I probably benign Het
Rab40c G A 17: 26,103,667 (GRCm39) T151I probably damaging Het
Rb1cc1 T A 1: 6,304,495 (GRCm39) probably null Het
Rnf145 T C 11: 44,415,815 (GRCm39) V10A probably benign Het
Rtn4rl2 T C 2: 84,711,036 (GRCm39) N70S probably damaging Het
Scaper A T 9: 55,766,326 (GRCm39) C483* probably null Het
Sema4a T A 3: 88,360,405 (GRCm39) Q58L possibly damaging Het
Slf1 T C 13: 77,249,067 (GRCm39) probably null Het
Sycp1 G T 3: 102,822,561 (GRCm39) N364K probably benign Het
Tenm4 T C 7: 96,545,482 (GRCm39) probably benign Het
Tnfaip2 A G 12: 111,417,141 (GRCm39) T537A probably damaging Het
Trappc12 A G 12: 28,753,596 (GRCm39) I573T possibly damaging Het
Ugt2b38 G A 5: 87,559,632 (GRCm39) T420I probably damaging Het
Ulk1 A T 5: 110,937,411 (GRCm39) probably benign Het
Unc80 G A 1: 66,688,103 (GRCm39) C2367Y possibly damaging Het
Usp7 C A 16: 8,521,366 (GRCm39) G135C probably damaging Het
Vmn2r103 A G 17: 20,014,189 (GRCm39) Y327C probably damaging Het
Vmn2r28 T A 7: 5,491,026 (GRCm39) H407L probably damaging Het
Zfp804a A C 2: 82,089,506 (GRCm39) T1112P probably damaging Het
Zfr2 A G 10: 81,081,242 (GRCm39) K431E probably damaging Het
Zfy1 A T Y: 725,850 (GRCm39) Y638* probably null Het
Other mutations in Mto1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Mto1 APN 9 78,368,925 (GRCm39) missense probably benign 0.00
IGL01362:Mto1 APN 9 78,360,056 (GRCm39) missense probably benign 0.00
IGL01906:Mto1 APN 9 78,372,213 (GRCm39) missense probably benign
IGL02499:Mto1 APN 9 78,368,794 (GRCm39) splice site probably benign
IGL02504:Mto1 APN 9 78,368,209 (GRCm39) missense probably damaging 1.00
IGL03104:Mto1 APN 9 78,356,802 (GRCm39) missense probably damaging 1.00
PIT4515001:Mto1 UTSW 9 78,364,699 (GRCm39) missense probably damaging 1.00
R0089:Mto1 UTSW 9 78,381,154 (GRCm39) missense probably benign
R0325:Mto1 UTSW 9 78,360,286 (GRCm39) missense probably damaging 1.00
R0566:Mto1 UTSW 9 78,355,583 (GRCm39) missense possibly damaging 0.66
R0659:Mto1 UTSW 9 78,378,072 (GRCm39) missense probably damaging 1.00
R0659:Mto1 UTSW 9 78,364,790 (GRCm39) missense probably damaging 1.00
R1679:Mto1 UTSW 9 78,372,245 (GRCm39) missense probably benign
R1899:Mto1 UTSW 9 78,368,799 (GRCm39) splice site probably benign
R1900:Mto1 UTSW 9 78,368,799 (GRCm39) splice site probably benign
R2235:Mto1 UTSW 9 78,364,846 (GRCm39) missense possibly damaging 0.58
R3078:Mto1 UTSW 9 78,365,310 (GRCm39) missense probably damaging 1.00
R5015:Mto1 UTSW 9 78,368,903 (GRCm39) missense probably benign 0.25
R5420:Mto1 UTSW 9 78,360,109 (GRCm39) missense probably benign
R5947:Mto1 UTSW 9 78,368,311 (GRCm39) missense probably damaging 1.00
R5969:Mto1 UTSW 9 78,360,187 (GRCm39) missense probably damaging 1.00
R6092:Mto1 UTSW 9 78,368,131 (GRCm39) missense possibly damaging 0.95
R6336:Mto1 UTSW 9 78,381,117 (GRCm39) missense probably damaging 0.98
R6542:Mto1 UTSW 9 78,364,510 (GRCm39) missense possibly damaging 0.94
R7092:Mto1 UTSW 9 78,377,955 (GRCm39) missense probably benign 0.25
R7150:Mto1 UTSW 9 78,364,565 (GRCm39) missense probably damaging 1.00
R7852:Mto1 UTSW 9 78,356,820 (GRCm39) missense possibly damaging 0.82
R8922:Mto1 UTSW 9 78,377,928 (GRCm39) missense probably benign
R9358:Mto1 UTSW 9 78,364,840 (GRCm39) missense probably benign 0.00
R9549:Mto1 UTSW 9 78,368,961 (GRCm39) missense probably benign 0.01
R9623:Mto1 UTSW 9 78,364,712 (GRCm39) missense probably damaging 1.00
RF014:Mto1 UTSW 9 78,355,598 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTGTTTTGTTGAGACATGGTTTCCCAC -3'
(R):5'- GCCCTAAGCCCTCACTCTAAGTCC -3'

Sequencing Primer
(F):5'- gtgggagactgaaatgaggg -3'
(R):5'- CCTCACTCTAAGTCCTCTATGAAATG -3'
Posted On 2013-10-16