Incidental Mutation 'R0837:Mthfs'
ID78001
Institutional Source Beutler Lab
Gene Symbol Mthfs
Ensembl Gene ENSMUSG00000066442
Gene Name5, 10-methenyltetrahydrofolate synthetase
Synonyms2310020H23Rik, 1110034I12Rik
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0837 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location89210676-89377713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89215390 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 100 (E100G)
Ref Sequence ENSEMBL: ENSMUSP00000112695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085256] [ENSMUST00000118870]
Predicted Effect probably damaging
Transcript: ENSMUST00000085256
AA Change: E100G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082354
Gene: ENSMUSG00000066442
AA Change: E100G

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 10 198 4.2e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117314
SMART Domains Protein: ENSMUSP00000112854
Gene: ENSMUSG00000066442

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 141 1.6e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118870
AA Change: E100G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112695
Gene: ENSMUSG00000066442
AA Change: E100G

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 10 128 1.2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118887
SMART Domains Protein: ENSMUSP00000112390
Gene: ENSMUSG00000066442

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 70 2.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127438
SMART Domains Protein: ENSMUSP00000122036
Gene: ENSMUSG00000066442

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 70 2.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127868
SMART Domains Protein: ENSMUSP00000118531
Gene: ENSMUSG00000066442

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 113 2.2e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138109
AA Change: E194G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119881
Gene: ENSMUSG00000100838
AA Change: E194G

DomainStartEndE-ValueType
BCL 31 134 5.55e-40 SMART
PDB:3HY6|A 135 221 4e-49 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149688
Predicted Effect probably benign
Transcript: ENSMUST00000185894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187362
Meta Mutation Damage Score 0.3957 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Heterozygous mice display decreased de novo purine synthesis and reduced plasma folate levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Mthfs
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0090:Mthfs UTSW 9 89211291 missense probably damaging 1.00
R0099:Mthfs UTSW 9 89226163 intron probably benign
R2047:Mthfs UTSW 9 89215303 missense probably damaging 1.00
R4796:Mthfs UTSW 9 89240025 missense probably benign 0.01
R6599:Mthfs UTSW 9 89239908 missense probably damaging 1.00
R8068:Mthfs UTSW 9 89211235 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCAGGTATCAGGGTGCAGTGTCAG -3'
(R):5'- CCCAGCTTCAGGGTGAGTCCTTTTAG -3'

Sequencing Primer
(F):5'- GTGATTGCCCACAATCAGTATCAG -3'
(R):5'- tgaagccaaccttgcctac -3'
Posted On2013-10-16