Incidental Mutation 'R0837:Elane'
ID78003
Institutional Source Beutler Lab
Gene Symbol Elane
Ensembl Gene ENSMUSG00000020125
Gene Nameelastase, neutrophil expressed
SynonymsNE, Ela2, F430011M15Rik
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0837 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79886247-79888215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79887108 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 116 (D116G)
Ref Sequence ENSEMBL: ENSMUSP00000038925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006679] [ENSMUST00000046091] [ENSMUST00000061653] [ENSMUST00000217837]
Predicted Effect probably benign
Transcript: ENSMUST00000006679
SMART Domains Protein: ENSMUSP00000006679
Gene: ENSMUSG00000057729

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Tryp_SPc 29 245 2.1e-77 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000046091
AA Change: D116G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038925
Gene: ENSMUSG00000020125
AA Change: D116G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Tryp_SPc 28 242 3.74e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061653
SMART Domains Protein: ENSMUSP00000056836
Gene: ENSMUSG00000061780

DomainStartEndE-ValueType
Tryp_SPc 25 249 8.25e-76 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165982
Predicted Effect probably benign
Transcript: ENSMUST00000166201
SMART Domains Protein: ENSMUSP00000129585
Gene: ENSMUSG00000057729

DomainStartEndE-ValueType
Tryp_SPc 5 125 1.26e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171489
Predicted Effect probably benign
Transcript: ENSMUST00000217837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218521
Meta Mutation Damage Score 0.9043 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: This gene encodes a member of the chymotrypsin-like family of serine protease enzymes that hydrolyzes a broad range of protein substrates including elastin. This gene is expressed by neutrophils where the encoded enzyme is stored in azurophil granules. Upon neutrophil activation, the active enzyme is released into the extracellular mileu. Mice lacking the encoded protein exhibit increased susceptibility to sepsis and death following intraperitoneal infection with Gram negative bacteria. This gene is located adjacent to a related proteinase gene on chromosome 10. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show impaired neutrophil physiology, susceptibility to Gram (-) bacterial infection, reduced sensitivity to xenobiotics, and abnormal local Shwartzman responses. Homozygotes for a knock-in allele show susceptibility to fungal infection and resistance to endotoxic shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Elane
AlleleSourceChrCoordTypePredicted EffectPPH Score
Ruo UTSW 10 79887108 missense probably damaging 1.00
R0167:Elane UTSW 10 79887099 splice site probably null
R0639:Elane UTSW 10 79886349 missense possibly damaging 0.53
R2001:Elane UTSW 10 79887759 missense possibly damaging 0.90
R2425:Elane UTSW 10 79887776 missense probably benign 0.12
R4751:Elane UTSW 10 79886791 missense probably benign 0.00
R5359:Elane UTSW 10 79887036 missense probably damaging 1.00
R6027:Elane UTSW 10 79887018 missense probably damaging 1.00
R7565:Elane UTSW 10 79887045 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- AACTTCGTCATGTCAGCAGCCC -3'
(R):5'- TCCAAGAGTTCCCCAAGCTTCAGG -3'

Sequencing Primer
(F):5'- TCAATGTCCATGCGGGTCAG -3'
(R):5'- agccttcaacattcagccc -3'
Posted On2013-10-16