Incidental Mutation 'R0837:Zfr2'
ID78004
Institutional Source Beutler Lab
Gene Symbol Zfr2
Ensembl Gene ENSMUSG00000034949
Gene Namezinc finger RNA binding protein 2
Synonyms9130206N08Rik, 2010013I23Rik
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R0837 (G1)
Quality Score224
Status Validated
Chromosome10
Chromosomal Location81233155-81252123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81245408 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 431 (K431E)
Ref Sequence ENSEMBL: ENSMUSP00000113913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117798]
Predicted Effect probably damaging
Transcript: ENSMUST00000117798
AA Change: K431E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113913
Gene: ENSMUSG00000034949
AA Change: K431E

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
low complexity region 44 62 N/A INTRINSIC
low complexity region 123 163 N/A INTRINSIC
ZnF_U1 202 236 3.58e-5 SMART
ZnF_C2H2 205 229 7.68e0 SMART
ZnF_U1 249 283 3.78e-4 SMART
ZnF_C2H2 252 276 4.12e0 SMART
ZnF_U1 397 431 3.78e-4 SMART
ZnF_C2H2 400 424 1.99e0 SMART
low complexity region 484 508 N/A INTRINSIC
DZF 585 837 2.06e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132174
Predicted Effect probably benign
Transcript: ENSMUST00000137999
SMART Domains Protein: ENSMUSP00000120853
Gene: ENSMUSG00000034949

DomainStartEndE-ValueType
Pfam:DZF 2 162 1.3e-32 PFAM
low complexity region 166 178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148029
Meta Mutation Damage Score 0.1555 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Zfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Zfr2 APN 10 81242085 missense probably damaging 0.96
IGL01622:Zfr2 APN 10 81251359 missense probably benign
IGL01623:Zfr2 APN 10 81251359 missense probably benign
IGL02719:Zfr2 APN 10 81244712 missense probably damaging 1.00
IGL03036:Zfr2 APN 10 81242151 missense probably benign 0.01
R0302:Zfr2 UTSW 10 81251336 unclassified probably benign
R1557:Zfr2 UTSW 10 81247391 missense probably benign 0.01
R1714:Zfr2 UTSW 10 81244749 missense probably damaging 1.00
R1737:Zfr2 UTSW 10 81242085 missense probably damaging 0.96
R1991:Zfr2 UTSW 10 81242852 missense possibly damaging 0.86
R2134:Zfr2 UTSW 10 81242901 missense probably damaging 1.00
R2148:Zfr2 UTSW 10 81242116 missense probably benign 0.13
R2150:Zfr2 UTSW 10 81242116 missense probably benign 0.13
R3703:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R3704:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R3705:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R3715:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R4301:Zfr2 UTSW 10 81242184 unclassified probably benign
R4654:Zfr2 UTSW 10 81251249 splice site probably null
R4811:Zfr2 UTSW 10 81243713 missense probably benign 0.07
R5290:Zfr2 UTSW 10 81246710 frame shift probably null
R5781:Zfr2 UTSW 10 81243713 missense probably benign 0.07
R7114:Zfr2 UTSW 10 81244725 missense probably damaging 1.00
R8192:Zfr2 UTSW 10 81242815 missense possibly damaging 0.83
R8359:Zfr2 UTSW 10 81242819 missense possibly damaging 0.57
R8389:Zfr2 UTSW 10 81245489 missense probably benign
R8827:Zfr2 UTSW 10 81242785 missense probably benign 0.00
X0063:Zfr2 UTSW 10 81242957 critical splice donor site probably null
Z1177:Zfr2 UTSW 10 81246084 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGCAGGACATTTCCCCAAAG -3'
(R):5'- GACATGGTAGCATTAGAGGTCACGG -3'

Sequencing Primer
(F):5'- AAGTGACCCATTTTGACTGCTG -3'
(R):5'- TAGCATTAGAGGTCACGGGATAC -3'
Posted On2013-10-16