Incidental Mutation 'R0837:Rnf145'
ID78005
Institutional Source Beutler Lab
Gene Symbol Rnf145
Ensembl Gene ENSMUSG00000019189
Gene Namering finger protein 145
Synonyms3732413I11Rik
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R0837 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location44518964-44565520 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44524988 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 10 (V10A)
Ref Sequence ENSEMBL: ENSMUSP00000019333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019333] [ENSMUST00000101327]
Predicted Effect probably benign
Transcript: ENSMUST00000019333
AA Change: V10A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000019333
Gene: ENSMUSG00000019189
AA Change: V10A

DomainStartEndE-ValueType
Pfam:TRC8_N 8 506 2.8e-156 PFAM
RING 537 574 2.12e-8 SMART
low complexity region 590 601 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101327
AA Change: V10A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098881
Gene: ENSMUSG00000019189
AA Change: V10A

DomainStartEndE-ValueType
Pfam:TRC8_N 7 266 1.2e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127907
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Rnf145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rnf145 APN 11 44555212 missense possibly damaging 0.90
IGL02972:Rnf145 APN 11 44564038 missense probably benign 0.26
IGL03168:Rnf145 APN 11 44555158 missense probably damaging 1.00
IGL03185:Rnf145 APN 11 44531330 missense probably damaging 1.00
IGL02980:Rnf145 UTSW 11 44561657 missense probably benign
R0112:Rnf145 UTSW 11 44564151 missense probably benign
R0346:Rnf145 UTSW 11 44555164 missense probably damaging 1.00
R0415:Rnf145 UTSW 11 44525138 missense probably damaging 0.99
R0452:Rnf145 UTSW 11 44561760 missense probably damaging 1.00
R0487:Rnf145 UTSW 11 44555229 missense probably benign 0.21
R0598:Rnf145 UTSW 11 44548943 missense probably damaging 1.00
R0631:Rnf145 UTSW 11 44560024 missense probably damaging 0.99
R1611:Rnf145 UTSW 11 44551798 missense probably damaging 1.00
R1971:Rnf145 UTSW 11 44548815 missense probably damaging 1.00
R1991:Rnf145 UTSW 11 44561466 missense possibly damaging 0.90
R2157:Rnf145 UTSW 11 44555170 missense probably damaging 1.00
R2340:Rnf145 UTSW 11 44531378 missense probably benign 0.04
R3855:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R4483:Rnf145 UTSW 11 44564277 missense probably benign 0.10
R4564:Rnf145 UTSW 11 44548808 missense probably benign 0.25
R4922:Rnf145 UTSW 11 44557236 unclassified probably benign
R5633:Rnf145 UTSW 11 44560088 missense probably damaging 1.00
R5672:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R5673:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R5701:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R5915:Rnf145 UTSW 11 44542722 critical splice donor site probably null
R6128:Rnf145 UTSW 11 44555191 missense probably damaging 1.00
R6502:Rnf145 UTSW 11 44525105 missense probably damaging 0.98
R6717:Rnf145 UTSW 11 44561490 missense probably benign 0.00
R6963:Rnf145 UTSW 11 44564277 missense probably benign 0.10
R7035:Rnf145 UTSW 11 44561756 missense probably damaging 1.00
R7154:Rnf145 UTSW 11 44524995 missense probably damaging 1.00
R7351:Rnf145 UTSW 11 44548796 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGAACCTGCCACACATCCATTACTG -3'
(R):5'- ACTCATCCATCGTGAAGCCAGAGC -3'

Sequencing Primer
(F):5'- GTGTGAATCACATTGAGGCAG -3'
(R):5'- CCAGAGCGCACATGCAG -3'
Posted On2013-10-16