Incidental Mutation 'R0837:Trappc12'
ID 78007
Institutional Source Beutler Lab
Gene Symbol Trappc12
Ensembl Gene ENSMUSG00000020628
Gene Name trafficking protein particle complex 12
Synonyms CGI-87, Ttc15, D930014A20Rik
MMRRC Submission 039016-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.366) question?
Stock # R0837 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 28740627-28800471 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28753596 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 573 (I573T)
Ref Sequence ENSEMBL: ENSMUSP00000127752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020954] [ENSMUST00000168129]
AlphaFold Q8K2L8
Predicted Effect possibly damaging
Transcript: ENSMUST00000020954
AA Change: I573T

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020954
Gene: ENSMUSG00000020628
AA Change: I573T

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
TPR 607 640 3.67e-3 SMART
TPR 642 675 1.44e1 SMART
TPR 682 715 3.37e-2 SMART
TPR 716 749 2.99e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168129
AA Change: I573T

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127752
Gene: ENSMUSG00000020628
AA Change: I573T

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
TPR 607 640 3.67e-3 SMART
TPR 642 675 1.44e1 SMART
TPR 682 715 3.37e-2 SMART
TPR 716 749 2.99e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223552
Meta Mutation Damage Score 0.4913 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,333,375 (GRCm39) probably benign Het
4930579C12Rik A G 9: 89,050,260 (GRCm39) noncoding transcript Het
Adam34 T A 8: 44,104,537 (GRCm39) K369N probably benign Het
Ap1g1 T C 8: 110,577,697 (GRCm39) W481R probably damaging Het
Bicdl1 G A 5: 115,869,351 (GRCm39) P26S probably benign Het
Cacna1c A T 6: 118,607,231 (GRCm39) C1224* probably null Het
Cpsf2 C T 12: 101,963,501 (GRCm39) probably benign Het
Cyp11b2 G A 15: 74,725,490 (GRCm39) R210W probably damaging Het
Dock7 C T 4: 98,877,495 (GRCm39) V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 (GRCm39) A2908S probably benign Het
Elane A G 10: 79,722,942 (GRCm39) D116G probably damaging Het
Epb41l2 C T 10: 25,383,714 (GRCm39) R153C probably damaging Het
Gucy2c G A 6: 136,699,418 (GRCm39) P617L probably damaging Het
H2ac21 G A 3: 96,127,439 (GRCm39) A70T probably damaging Het
Kcnq4 T A 4: 120,604,058 (GRCm39) I106L probably benign Het
Man2b1 A G 8: 85,823,458 (GRCm39) N931D possibly damaging Het
Mthfs A G 9: 89,097,443 (GRCm39) E100G probably damaging Het
Mto1 A T 9: 78,381,072 (GRCm39) I639F probably damaging Het
Myo15a A G 11: 60,378,077 (GRCm39) E177G probably damaging Het
Naip5 T A 13: 100,367,251 (GRCm39) M282L probably benign Het
Or10aa1 A G 1: 173,870,053 (GRCm39) D179G probably damaging Het
Pik3c2g G A 6: 139,903,425 (GRCm39) probably benign Het
Prl7d1 T A 13: 27,898,321 (GRCm39) M64L probably benign Het
Prnp A T 2: 131,778,444 (GRCm39) N32I probably damaging Het
Ptpn11 C T 5: 121,287,174 (GRCm39) V406I probably benign Het
Rab40c G A 17: 26,103,667 (GRCm39) T151I probably damaging Het
Rb1cc1 T A 1: 6,304,495 (GRCm39) probably null Het
Rnf145 T C 11: 44,415,815 (GRCm39) V10A probably benign Het
Rtn4rl2 T C 2: 84,711,036 (GRCm39) N70S probably damaging Het
Scaper A T 9: 55,766,326 (GRCm39) C483* probably null Het
Sema4a T A 3: 88,360,405 (GRCm39) Q58L possibly damaging Het
Slf1 T C 13: 77,249,067 (GRCm39) probably null Het
Sycp1 G T 3: 102,822,561 (GRCm39) N364K probably benign Het
Tenm4 T C 7: 96,545,482 (GRCm39) probably benign Het
Tnfaip2 A G 12: 111,417,141 (GRCm39) T537A probably damaging Het
Ugt2b38 G A 5: 87,559,632 (GRCm39) T420I probably damaging Het
Ulk1 A T 5: 110,937,411 (GRCm39) probably benign Het
Unc80 G A 1: 66,688,103 (GRCm39) C2367Y possibly damaging Het
Usp7 C A 16: 8,521,366 (GRCm39) G135C probably damaging Het
Vmn2r103 A G 17: 20,014,189 (GRCm39) Y327C probably damaging Het
Vmn2r28 T A 7: 5,491,026 (GRCm39) H407L probably damaging Het
Zfp804a A C 2: 82,089,506 (GRCm39) T1112P probably damaging Het
Zfr2 A G 10: 81,081,242 (GRCm39) K431E probably damaging Het
Zfy1 A T Y: 725,850 (GRCm39) Y638* probably null Het
Other mutations in Trappc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Trappc12 APN 12 28,787,835 (GRCm39) missense probably damaging 0.99
IGL01018:Trappc12 APN 12 28,741,853 (GRCm39) splice site probably benign
IGL01295:Trappc12 APN 12 28,796,761 (GRCm39) missense probably damaging 1.00
IGL01365:Trappc12 APN 12 28,797,401 (GRCm39) missense probably damaging 1.00
IGL01490:Trappc12 APN 12 28,796,914 (GRCm39) missense probably damaging 1.00
IGL01975:Trappc12 APN 12 28,742,491 (GRCm39) critical splice donor site probably null
IGL02851:Trappc12 APN 12 28,741,405 (GRCm39) missense probably damaging 0.98
IGL02885:Trappc12 APN 12 28,797,013 (GRCm39) missense probably benign
IGL03163:Trappc12 APN 12 28,796,653 (GRCm39) missense probably damaging 1.00
R0102:Trappc12 UTSW 12 28,796,751 (GRCm39) missense probably damaging 1.00
R0102:Trappc12 UTSW 12 28,796,751 (GRCm39) missense probably damaging 1.00
R0330:Trappc12 UTSW 12 28,797,259 (GRCm39) missense probably benign 0.00
R0517:Trappc12 UTSW 12 28,747,133 (GRCm39) splice site probably benign
R1439:Trappc12 UTSW 12 28,797,160 (GRCm39) missense possibly damaging 0.96
R1477:Trappc12 UTSW 12 28,787,751 (GRCm39) missense probably benign 0.25
R1651:Trappc12 UTSW 12 28,741,776 (GRCm39) missense probably benign 0.32
R1899:Trappc12 UTSW 12 28,796,984 (GRCm39) missense probably damaging 0.97
R1900:Trappc12 UTSW 12 28,796,984 (GRCm39) missense probably damaging 0.97
R2133:Trappc12 UTSW 12 28,796,597 (GRCm39) missense probably benign 0.00
R2174:Trappc12 UTSW 12 28,797,380 (GRCm39) missense possibly damaging 0.94
R4449:Trappc12 UTSW 12 28,797,234 (GRCm39) missense probably benign 0.05
R5031:Trappc12 UTSW 12 28,742,512 (GRCm39) missense possibly damaging 0.86
R5209:Trappc12 UTSW 12 28,787,793 (GRCm39) missense probably benign 0.03
R5220:Trappc12 UTSW 12 28,796,696 (GRCm39) missense probably damaging 0.97
R5458:Trappc12 UTSW 12 28,796,389 (GRCm39) missense probably damaging 0.98
R5471:Trappc12 UTSW 12 28,741,499 (GRCm39) missense probably damaging 1.00
R5482:Trappc12 UTSW 12 28,741,324 (GRCm39) missense probably damaging 0.97
R5808:Trappc12 UTSW 12 28,796,863 (GRCm39) missense probably damaging 1.00
R5916:Trappc12 UTSW 12 28,741,513 (GRCm39) missense probably damaging 1.00
R5996:Trappc12 UTSW 12 28,797,113 (GRCm39) missense possibly damaging 0.83
R6378:Trappc12 UTSW 12 28,797,082 (GRCm39) missense probably damaging 0.97
R7669:Trappc12 UTSW 12 28,761,957 (GRCm39) missense probably benign 0.30
R9233:Trappc12 UTSW 12 28,772,414 (GRCm39) missense possibly damaging 0.88
R9323:Trappc12 UTSW 12 28,742,491 (GRCm39) critical splice donor site probably null
R9361:Trappc12 UTSW 12 28,796,417 (GRCm39) missense probably damaging 0.99
R9550:Trappc12 UTSW 12 28,761,985 (GRCm39) critical splice acceptor site probably null
R9784:Trappc12 UTSW 12 28,797,457 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACTGGGTAAAAGCCCACGTCCTTC -3'
(R):5'- TGCTCCCACAGCACTTGATCAC -3'

Sequencing Primer
(F):5'- CCTATCCAGAGTAGATGCTACAGG -3'
(R):5'- GAAGGCTCTATGAGTCTCATAAGC -3'
Posted On 2013-10-16