Mutagenetix > Incidental Mutation

Incidental Mutation 'R0837:Tnfaip2'

78009

Institutional Source

Beutler Lab

Gene Symbol

Tnfaip2

Ensembl Gene

ENSMUSG00000021281

Gene Name

tumor necrosis factor, alpha-induced protein 2

Synonyms

Tnfaip2, tnfb94, Tnfip2

MMRRC Submission

039016-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0837 (G1)

Quality Score

202

Status

Validated

Chromosome

Chromosomal Location

111442469-111455018 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 111450707 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 537 (T537A)

Ref Sequence

ENSEMBL: ENSMUSP00000105415 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102745] [ENSMUST00000109792] [ENSMUST00000172783] [ENSMUST00000174298]

AlphaFold

Q61333

Predicted Effect

probably damaging
Transcript: ENSMUST00000102745
AA Change: T520A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099806
Gene: ENSMUSG00000021281
AA Change: T520A

Domain	Start	End	E-Value	Type
low complexity region	32	48	N/A	INTRINSIC
low complexity region	60	72	N/A	INTRINSIC
low complexity region	83	89	N/A	INTRINSIC
low complexity region	141	147	N/A	INTRINSIC
Pfam:Sec6	157	688	1.3e-111	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109792
AA Change: T537A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105415
Gene: ENSMUSG00000021281
AA Change: T537A

Domain	Start	End	E-Value	Type
low complexity region	32	48	N/A	INTRINSIC
low complexity region	60	72	N/A	INTRINSIC
low complexity region	83	89	N/A	INTRINSIC
low complexity region	141	147	N/A	INTRINSIC
Pfam:Sec6	157	705	1.7e-107	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127028

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127207

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133865

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156003

Predicted Effect

probably benign
Transcript: ENSMUST00000172783

SMART Domains

Protein: ENSMUSP00000133635
Gene: ENSMUSG00000021281

Domain	Start	End	E-Value	Type
low complexity region	32	48	N/A	INTRINSIC
low complexity region	60	72	N/A	INTRINSIC
low complexity region	83	89	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173581

Predicted Effect

probably benign
Transcript: ENSMUST00000174298

SMART Domains

Protein: ENSMUSP00000133317
Gene: ENSMUSG00000021281

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
low complexity region	42	54	N/A	INTRINSIC
low complexity region	65	71	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174692

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221429

Meta Mutation Damage Score

0.3292

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.8%

Validation Efficiency

96% (44/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a gene whose expression can be induced by the tumor necrosis factor alpha (TNF) in umbilical vein endothelial cells. The expression of this gene was shown to be induced by retinoic acid in a cell line expressing a oncogenic version of the retinoic acid receptor alpha fusion protein, which suggested that this gene may be a retinoic acid target gene in acute promyelocytic leukemia. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563I02Rik	T	C	14: 60,095,926		probably benign	Het
4930579C12Rik	A	G	9: 89,168,207		noncoding transcript	Het
Adam34	T	A	8: 43,651,500	K369N	probably benign	Het
Ap1g1	T	C	8: 109,851,065	W481R	probably damaging	Het
Bicdl1	G	A	5: 115,731,292	P26S	probably benign	Het
Cacna1c	A	T	6: 118,630,270	C1224*	probably null	Het
Cpsf2	C	T	12: 101,997,242		probably benign	Het
Cyp11b2	G	A	15: 74,853,641	R210W	probably damaging	Het
Dock7	C	T	4: 98,989,258	V1048I	probably benign	Het
Dync2h1	C	A	9: 7,077,979	A2908S	probably benign	Het
Elane	A	G	10: 79,887,108	D116G	probably damaging	Het
Epb41l2	C	T	10: 25,507,816	R153C	probably damaging	Het
Gucy2c	G	A	6: 136,722,420	P617L	probably damaging	Het
Hist2h2ab	G	A	3: 96,220,123	A70T	probably damaging	Het
Kcnq4	T	A	4: 120,746,861	I106L	probably benign	Het
Man2b1	A	G	8: 85,096,829	N931D	possibly damaging	Het
Mthfs	A	G	9: 89,215,390	E100G	probably damaging	Het
Mto1	A	T	9: 78,473,790	I639F	probably damaging	Het
Myo15	A	G	11: 60,487,251	E177G	probably damaging	Het
Naip5	T	A	13: 100,230,743	M282L	probably benign	Het
Olfr433	A	G	1: 174,042,487	D179G	probably damaging	Het
Pik3c2g	G	A	6: 139,957,699		probably benign	Het
Prl7d1	T	A	13: 27,714,338	M64L	probably benign	Het
Prnp	A	T	2: 131,936,524	N32I	probably damaging	Het
Ptpn11	C	T	5: 121,149,111	V406I	probably benign	Het
Rab40c	G	A	17: 25,884,693	T151I	probably damaging	Het
Rb1cc1	T	A	1: 6,234,271		probably null	Het
Rnf145	T	C	11: 44,524,988	V10A	probably benign	Het
Rtn4rl2	T	C	2: 84,880,692	N70S	probably damaging	Het
Scaper	A	T	9: 55,859,042	C483*	probably null	Het
Sema4a	T	A	3: 88,453,098	Q58L	possibly damaging	Het
Slf1	T	C	13: 77,100,948		probably null	Het
Sycp1	G	T	3: 102,915,245	N364K	probably benign	Het
Tenm4	T	C	7: 96,896,275		probably benign	Het
Trappc12	A	G	12: 28,703,597	I573T	possibly damaging	Het
Ugt2b38	G	A	5: 87,411,773	T420I	probably damaging	Het
Ulk1	A	T	5: 110,789,545		probably benign	Het
Unc80	G	A	1: 66,648,944	C2367Y	possibly damaging	Het
Usp7	C	A	16: 8,703,502	G135C	probably damaging	Het
Vmn2r103	A	G	17: 19,793,927	Y327C	probably damaging	Het
Vmn2r28	T	A	7: 5,488,027	H407L	probably damaging	Het
Zfp804a	A	C	2: 82,259,162	T1112P	probably damaging	Het
Zfr2	A	G	10: 81,245,408	K431E	probably damaging	Het
Zfy1	A	T	Y: 725,850	Y638*	probably null	Het

Other mutations in Tnfaip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00916:Tnfaip2	APN	12	111453549	missense	probably damaging	1.00
IGL01352:Tnfaip2	APN	12	111445619	missense	probably damaging	1.00
IGL02550:Tnfaip2	APN	12	111446101	missense	probably damaging	1.00
R0103:Tnfaip2	UTSW	12	111445810	missense	probably benign	0.38
R0145:Tnfaip2	UTSW	12	111445858	missense	possibly damaging	0.87
R0324:Tnfaip2	UTSW	12	111453459	missense	probably damaging	1.00
R0609:Tnfaip2	UTSW	12	111453507	missense	probably benign	0.01
R1353:Tnfaip2	UTSW	12	111444969	missense	probably damaging	1.00
R1366:Tnfaip2	UTSW	12	111449322	missense	probably benign	0.00
R1988:Tnfaip2	UTSW	12	111449891	critical splice donor site	probably null
R2109:Tnfaip2	UTSW	12	111448093	missense	probably damaging	1.00
R2147:Tnfaip2	UTSW	12	111446022	missense	probably damaging	1.00
R4003:Tnfaip2	UTSW	12	111451344	splice site	probably benign
R4402:Tnfaip2	UTSW	12	111449851	missense	probably benign	0.43
R4690:Tnfaip2	UTSW	12	111445248	missense	possibly damaging	0.66
R4718:Tnfaip2	UTSW	12	111446029	missense	possibly damaging	0.95
R5271:Tnfaip2	UTSW	12	111448460	intron	probably benign
R6478:Tnfaip2	UTSW	12	111445663	missense	probably damaging	1.00
R7623:Tnfaip2	UTSW	12	111445638	missense	probably damaging	0.98
R8951:Tnfaip2	UTSW	12	111445876	missense	probably benign	0.01
R9168:Tnfaip2	UTSW	12	111444948	missense	probably damaging	1.00
R9407:Tnfaip2	UTSW	12	111445727	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCAGACAGGCTCATTTTGGCTCTC -3'
(R):5'- GCTCACATTCTCAGTGCAGAACCC -3'

Sequencing Primer
(F):5'- AGGGTACACTCAGACTGCCTC -3'
(R):5'- TGCAGAACCCCTGAATGG -3'

Posted On

2013-10-16