Incidental Mutation 'R0837:Tnfaip2'
ID78009
Institutional Source Beutler Lab
Gene Symbol Tnfaip2
Ensembl Gene ENSMUSG00000021281
Gene Nametumor necrosis factor, alpha-induced protein 2
SynonymsTnfaip2, tnfb94, Tnfip2
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0837 (G1)
Quality Score202
Status Validated
Chromosome12
Chromosomal Location111442469-111455018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111450707 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 537 (T537A)
Ref Sequence ENSEMBL: ENSMUSP00000105415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102745] [ENSMUST00000109792] [ENSMUST00000172783] [ENSMUST00000174298]
Predicted Effect probably damaging
Transcript: ENSMUST00000102745
AA Change: T520A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099806
Gene: ENSMUSG00000021281
AA Change: T520A

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
Pfam:Sec6 157 688 1.3e-111 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109792
AA Change: T537A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105415
Gene: ENSMUSG00000021281
AA Change: T537A

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
Pfam:Sec6 157 705 1.7e-107 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156003
Predicted Effect probably benign
Transcript: ENSMUST00000172783
SMART Domains Protein: ENSMUSP00000133635
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173581
Predicted Effect probably benign
Transcript: ENSMUST00000174298
SMART Domains Protein: ENSMUSP00000133317
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
low complexity region 42 54 N/A INTRINSIC
low complexity region 65 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221429
Meta Mutation Damage Score 0.3292 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a gene whose expression can be induced by the tumor necrosis factor alpha (TNF) in umbilical vein endothelial cells. The expression of this gene was shown to be induced by retinoic acid in a cell line expressing a oncogenic version of the retinoic acid receptor alpha fusion protein, which suggested that this gene may be a retinoic acid target gene in acute promyelocytic leukemia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Tnfaip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Tnfaip2 APN 12 111453549 missense probably damaging 1.00
IGL01352:Tnfaip2 APN 12 111445619 missense probably damaging 1.00
IGL02550:Tnfaip2 APN 12 111446101 missense probably damaging 1.00
R0103:Tnfaip2 UTSW 12 111445810 missense probably benign 0.38
R0145:Tnfaip2 UTSW 12 111445858 missense possibly damaging 0.87
R0324:Tnfaip2 UTSW 12 111453459 missense probably damaging 1.00
R0609:Tnfaip2 UTSW 12 111453507 missense probably benign 0.01
R1353:Tnfaip2 UTSW 12 111444969 missense probably damaging 1.00
R1366:Tnfaip2 UTSW 12 111449322 missense probably benign 0.00
R1988:Tnfaip2 UTSW 12 111449891 critical splice donor site probably null
R2109:Tnfaip2 UTSW 12 111448093 missense probably damaging 1.00
R2147:Tnfaip2 UTSW 12 111446022 missense probably damaging 1.00
R4003:Tnfaip2 UTSW 12 111451344 splice site probably benign
R4402:Tnfaip2 UTSW 12 111449851 missense probably benign 0.43
R4690:Tnfaip2 UTSW 12 111445248 missense possibly damaging 0.66
R4718:Tnfaip2 UTSW 12 111446029 missense possibly damaging 0.95
R5271:Tnfaip2 UTSW 12 111448460 intron probably benign
R6478:Tnfaip2 UTSW 12 111445663 missense probably damaging 1.00
R7623:Tnfaip2 UTSW 12 111445638 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAGACAGGCTCATTTTGGCTCTC -3'
(R):5'- GCTCACATTCTCAGTGCAGAACCC -3'

Sequencing Primer
(F):5'- AGGGTACACTCAGACTGCCTC -3'
(R):5'- TGCAGAACCCCTGAATGG -3'
Posted On2013-10-16