Incidental Mutation 'R0837:Cyp11b2'
ID78014
Institutional Source Beutler Lab
Gene Symbol Cyp11b2
Ensembl Gene ENSMUSG00000022589
Gene Namecytochrome P450, family 11, subfamily b, polypeptide 2
SynonymsCyp11b-2, Cyp11b, aldosterone synthase, steroid-11-beta-hydroxylase
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0837 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location74851010-74856318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74853641 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 210 (R210W)
Ref Sequence ENSEMBL: ENSMUSP00000131503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167634]
Predicted Effect probably damaging
Transcript: ENSMUST00000167634
AA Change: R210W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131503
Gene: ENSMUSG00000022589
AA Change: R210W

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:p450 44 498 1e-115 PFAM
Meta Mutation Damage Score 0.2631 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and is involved in the conversion of progesterone to cortisol in the adrenal cortex. Mutations in this gene cause congenital adrenal hyperplasia due to 11-beta-hydroxylase deficiency. Transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some postnatal lethality, altered blood chemistry, hypotension, and abnormal adrenal cortex morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Cyp11b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Cyp11b2 APN 15 74853515 missense probably benign 0.00
IGL02058:Cyp11b2 APN 15 74853189 missense probably benign 0.30
IGL02419:Cyp11b2 APN 15 74851055 missense probably damaging 1.00
IGL03094:Cyp11b2 APN 15 74853037 critical splice donor site probably null
IGL03237:Cyp11b2 APN 15 74851065 missense probably benign 0.00
Spargel UTSW 15 74851432 missense probably damaging 1.00
stickfigure UTSW 15 74851570 missense possibly damaging 0.46
Stringbean UTSW 15 74853130 missense probably damaging 1.00
veronica UTSW 15 74853991 missense probably damaging 1.00
PIT4243001:Cyp11b2 UTSW 15 74851453 missense probably damaging 1.00
R0522:Cyp11b2 UTSW 15 74851684 splice site probably benign
R0674:Cyp11b2 UTSW 15 74855544 missense probably damaging 1.00
R1386:Cyp11b2 UTSW 15 74851775 critical splice acceptor site probably null
R1423:Cyp11b2 UTSW 15 74853130 missense probably damaging 1.00
R1550:Cyp11b2 UTSW 15 74853593 missense probably benign 0.07
R3437:Cyp11b2 UTSW 15 74855449 missense probably benign
R3693:Cyp11b2 UTSW 15 74856008 missense probably benign 0.00
R4447:Cyp11b2 UTSW 15 74855563 missense probably benign 0.00
R4870:Cyp11b2 UTSW 15 74853146 missense probably benign 0.00
R4947:Cyp11b2 UTSW 15 74851570 missense possibly damaging 0.46
R4968:Cyp11b2 UTSW 15 74854005 splice site probably null
R5115:Cyp11b2 UTSW 15 74855428 critical splice donor site probably null
R5775:Cyp11b2 UTSW 15 74853478 missense probably benign 0.02
R6738:Cyp11b2 UTSW 15 74853514 missense possibly damaging 0.65
R6841:Cyp11b2 UTSW 15 74855491 missense probably benign 0.00
R6942:Cyp11b2 UTSW 15 74856245 start gained probably benign
R6997:Cyp11b2 UTSW 15 74851432 missense probably damaging 1.00
R7094:Cyp11b2 UTSW 15 74853658 missense possibly damaging 0.94
R7096:Cyp11b2 UTSW 15 74855988 missense probably damaging 0.98
R7275:Cyp11b2 UTSW 15 74853991 missense probably damaging 1.00
R7456:Cyp11b2 UTSW 15 74853530 missense probably benign 0.01
R7604:Cyp11b2 UTSW 15 74853750 splice site probably null
R8002:Cyp11b2 UTSW 15 74856032 missense probably damaging 1.00
R8222:Cyp11b2 UTSW 15 74856210 missense probably benign 0.03
R8346:Cyp11b2 UTSW 15 74851768 missense probably damaging 1.00
R8349:Cyp11b2 UTSW 15 74851579 missense possibly damaging 0.94
R8449:Cyp11b2 UTSW 15 74851579 missense possibly damaging 0.94
R8537:Cyp11b2 UTSW 15 74856167 missense probably benign 0.01
R8785:Cyp11b2 UTSW 15 74852112 missense probably benign 0.44
R8824:Cyp11b2 UTSW 15 74856065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCGAAATGTTCTTTCCACACCC -3'
(R):5'- GTGCTGTCACCAAAAGCCGTTC -3'

Sequencing Primer
(F):5'- ATGTTCTTTCCACACCCGAGTG -3'
(R):5'- AAGGTGCTTCAAAATGCTCGTG -3'
Posted On2013-10-16