Incidental Mutation 'R0837:Rab40c'
ID78017
Institutional Source Beutler Lab
Gene Symbol Rab40c
Ensembl Gene ENSMUSG00000025730
Gene NameRab40C, member RAS oncogene family
SynonymsRAR3
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock #R0837 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25882114-25919727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25884693 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 151 (T151I)
Ref Sequence ENSEMBL: ENSMUSP00000136612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026826] [ENSMUST00000095487] [ENSMUST00000163356] [ENSMUST00000164738] [ENSMUST00000164982] [ENSMUST00000166146] [ENSMUST00000167018] [ENSMUST00000167626] [ENSMUST00000176696] [ENSMUST00000179998]
Predicted Effect probably damaging
Transcript: ENSMUST00000026826
AA Change: T151I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026826
Gene: ENSMUSG00000025730
AA Change: T151I

DomainStartEndE-ValueType
RAB 15 177 9.2e-77 SMART
SOCS 183 226 1.6e-18 SMART
SOCS_box 189 225 7.2e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095487
SMART Domains Protein: ENSMUSP00000093141
Gene: ENSMUSG00000071192

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 32 82 4.04e-3 SMART
KAZAL 119 161 1.96e-2 SMART
IGc2 202 274 2.54e-14 SMART
KU 301 356 4.2e-3 SMART
KU 361 414 1.82e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163356
SMART Domains Protein: ENSMUSP00000130209
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 172 1.6e-74 PFAM
Pfam:Methyltransf_25 31 133 9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164738
SMART Domains Protein: ENSMUSP00000130093
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
Pfam:Arf 5 110 5.2e-7 PFAM
Pfam:Miro 16 111 4.2e-12 PFAM
Pfam:Ras 16 111 2.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164982
AA Change: T132I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127868
Gene: ENSMUSG00000025730
AA Change: T132I

DomainStartEndE-ValueType
RAB 15 158 5.56e-54 SMART
SOCS 164 207 2.56e-16 SMART
SOCS_box 170 206 9.29e-6 SMART
low complexity region 219 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166146
SMART Domains Protein: ENSMUSP00000132355
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
SCOP:d3raba_ 10 43 3e-9 SMART
Blast:RAB 15 49 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166619
Predicted Effect probably damaging
Transcript: ENSMUST00000167018
AA Change: T151I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131055
Gene: ENSMUSG00000025730
AA Change: T151I

DomainStartEndE-ValueType
RAB 15 177 1.88e-74 SMART
SOCS 183 226 2.56e-16 SMART
SOCS_box 189 225 9.29e-6 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167626
AA Change: T151I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127546
Gene: ENSMUSG00000025730
AA Change: T151I

DomainStartEndE-ValueType
RAB 15 177 9.2e-77 SMART
SOCS 183 226 1.6e-18 SMART
SOCS_box 189 225 7.2e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172168
Predicted Effect probably benign
Transcript: ENSMUST00000176696
SMART Domains Protein: ENSMUSP00000135083
Gene: ENSMUSG00000071192

DomainStartEndE-ValueType
WAP 2 48 8.8e-2 SMART
KAZAL 85 127 1.96e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179998
AA Change: T151I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136612
Gene: ENSMUSG00000025730
AA Change: T151I

DomainStartEndE-ValueType
RAB 15 177 9.4e-77 SMART
SOCS 183 226 1.7e-18 SMART
SOCS_box 189 225 7.3e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Rab40c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Rab40c APN 17 25885085 missense probably damaging 1.00
IGL01793:Rab40c APN 17 25884622 missense probably damaging 1.00
IGL01936:Rab40c APN 17 25884670 missense probably damaging 0.99
R0089:Rab40c UTSW 17 25885148 missense probably damaging 1.00
R0456:Rab40c UTSW 17 25884657 missense possibly damaging 0.68
R1547:Rab40c UTSW 17 25883750 missense probably damaging 1.00
R5488:Rab40c UTSW 17 25890669 missense probably damaging 0.98
R5955:Rab40c UTSW 17 25884657 missense probably damaging 0.98
R7047:Rab40c UTSW 17 25919484 missense probably damaging 0.98
X0028:Rab40c UTSW 17 25890708 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTGCTGAGTTGCACATCCTGCC -3'
(R):5'- GTGCCTCTGCTAAGTTCTGAACCC -3'

Sequencing Primer
(F):5'- TAGGTCTGAGCAGGCAGTC -3'
(R):5'- GCTAAGTTCTGAACCCCCTATC -3'
Posted On2013-10-16