Incidental Mutation 'R0838:Chit1'
ID78021
Institutional Source Beutler Lab
Gene Symbol Chit1
Ensembl Gene ENSMUSG00000026450
Gene Namechitinase 1 (chitotriosidase)
Synonyms
MMRRC Submission 039017-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R0838 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location134111242-134151540 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 134143337 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 51 (C51*)
Ref Sequence ENSEMBL: ENSMUSP00000124331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086475] [ENSMUST00000159963] [ENSMUST00000160060]
Predicted Effect probably null
Transcript: ENSMUST00000086475
AA Change: C51*
SMART Domains Protein: ENSMUSP00000083666
Gene: ENSMUSG00000026450
AA Change: C51*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 361 6.69e-151 SMART
ChtBD2 416 464 5.56e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159963
AA Change: C51*
SMART Domains Protein: ENSMUSP00000123979
Gene: ENSMUSG00000026450
AA Change: C51*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 361 6.69e-151 SMART
ChtBD2 416 464 5.56e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160060
AA Change: C51*
SMART Domains Protein: ENSMUSP00000124331
Gene: ENSMUSG00000026450
AA Change: C51*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 354 2.47e-131 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chitotriosidase is secreted by activated human macrophages and is markedly elevated in plasma of Gaucher disease patients. The expression of chitotriosidase occurs only at a late stage of differentiation of monocytes to activated macrophages in culture. Human macrophages can synthesize a functional chitotriosidase, a highly conserved enzyme with a strongly regulated expression. This enzyme may play a role in the degradation of chitin-containing pathogens. Several alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced pulmonary fibrosis induced by bleomycin or IL13 expression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,468 S513P possibly damaging Het
2310057M21Rik T A 7: 131,361,806 M53L probably damaging Het
Adamts6 A G 13: 104,413,789 N638D possibly damaging Het
Amy2b T C 3: 113,151,001 noncoding transcript Het
Ap5s1 G A 2: 131,211,431 R45K probably damaging Het
Arap1 T C 7: 101,400,412 Y994H probably damaging Het
Arrdc3 A T 13: 80,889,247 probably benign Het
Bard1 G A 1: 71,030,653 T722M probably damaging Het
Ccdc88a A G 11: 29,400,285 Y89C probably damaging Het
Cd96 A G 16: 46,117,926 S59P probably damaging Het
Cilp2 G T 8: 69,881,719 H876Q probably benign Het
Cyld A G 8: 88,741,350 E722G probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dedd2 T C 7: 25,211,187 E188G probably benign Het
Dnah17 A T 11: 118,060,104 W2898R probably damaging Het
Dpy19l1 T C 9: 24,432,431 T473A probably damaging Het
Fam228a T A 12: 4,735,002 H43L possibly damaging Het
Fkbp15 G T 4: 62,324,126 H530N probably damaging Het
Gga1 C T 15: 78,891,918 S387L probably damaging Het
Gm14124 T A 2: 150,269,300 C637S possibly damaging Het
Gm4868 A G 5: 125,848,623 noncoding transcript Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Itgb4 A C 11: 115,998,162 probably benign Het
Jag1 G A 2: 137,093,278 T388I probably damaging Het
Kcnh1 A G 1: 192,413,206 D551G probably damaging Het
Lrp2bp A G 8: 46,025,124 D270G possibly damaging Het
Map3k19 C A 1: 127,823,959 V552F probably benign Het
Mixl1 A T 1: 180,696,800 D71E probably benign Het
Myocd A G 11: 65,178,932 I694T probably benign Het
Nadk2 T A 15: 9,091,242 S198T probably benign Het
Npepps A T 11: 97,267,692 probably benign Het
Nt5c1b C T 12: 10,375,071 Q206* probably null Het
Olfr64 T A 7: 103,893,415 I107F probably benign Het
Orm1 A G 4: 63,345,157 Y69C probably damaging Het
Plscr4 T A 9: 92,471,760 probably benign Het
Pon1 G A 6: 5,175,758 T188I possibly damaging Het
Ppm1a T A 12: 72,784,320 H206Q probably benign Het
Prl8a1 G A 13: 27,574,025 R234C probably damaging Het
Rfx3 C T 19: 27,849,967 R73Q possibly damaging Het
Rims2 T C 15: 39,681,025 V1466A probably benign Het
Sec24d T A 3: 123,305,836 F319L probably benign Het
Slc15a4 A G 5: 127,617,003 S123P possibly damaging Het
Slc1a6 A T 10: 78,796,222 D294V probably damaging Het
Slc28a3 A T 13: 58,588,269 D38E probably benign Het
Stard3nl A G 13: 19,372,586 probably null Het
Stard9 A G 2: 120,700,842 T2527A probably damaging Het
Sult3a1 C T 10: 33,879,288 P283L probably damaging Het
Tgtp1 A G 11: 48,987,143 V245A probably benign Het
Txndc16 T C 14: 45,165,419 probably benign Het
Zdhhc8 A G 16: 18,224,566 L590S probably damaging Het
Zfp366 A G 13: 99,228,610 E93G possibly damaging Het
Zfp69 T C 4: 120,931,281 N279S probably benign Het
Zscan10 T C 17: 23,610,034 S407P possibly damaging Het
Other mutations in Chit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Chit1 APN 1 134145254 missense probably damaging 1.00
IGL01344:Chit1 APN 1 134151314 missense probably damaging 1.00
IGL01352:Chit1 APN 1 134148490 missense probably damaging 1.00
IGL01620:Chit1 APN 1 134150519 missense probably damaging 1.00
IGL01795:Chit1 APN 1 134148429 missense probably damaging 1.00
IGL01924:Chit1 APN 1 134149410 missense probably benign 0.05
IGL02000:Chit1 APN 1 134146675 missense probably benign 0.01
IGL02891:Chit1 APN 1 134145310 missense probably benign 0.38
Debt UTSW 1 134149425 missense probably null 1.00
R0790:Chit1 UTSW 1 134138752 missense probably benign 0.00
R1783:Chit1 UTSW 1 134149394 missense possibly damaging 0.67
R1783:Chit1 UTSW 1 134149395 missense probably benign 0.03
R1784:Chit1 UTSW 1 134149394 missense possibly damaging 0.67
R1863:Chit1 UTSW 1 134151250 missense probably damaging 0.96
R1940:Chit1 UTSW 1 134145418 critical splice donor site probably null
R1950:Chit1 UTSW 1 134151230 missense probably damaging 1.00
R2045:Chit1 UTSW 1 134151144 missense probably benign 0.05
R2260:Chit1 UTSW 1 134151127 missense probably benign
R4552:Chit1 UTSW 1 134144051 missense probably benign 0.17
R5386:Chit1 UTSW 1 134149454 missense probably damaging 1.00
R5975:Chit1 UTSW 1 134146626 missense probably damaging 1.00
R6134:Chit1 UTSW 1 134144060 missense possibly damaging 0.94
R6196:Chit1 UTSW 1 134146643 nonsense probably null
R6482:Chit1 UTSW 1 134143242 missense probably damaging 0.98
R6923:Chit1 UTSW 1 134149425 missense probably null 1.00
R6952:Chit1 UTSW 1 134143284 missense probably damaging 1.00
R7022:Chit1 UTSW 1 134151292 missense probably benign 0.44
R7198:Chit1 UTSW 1 134150491 missense possibly damaging 0.87
R8079:Chit1 UTSW 1 134144027 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGACACTCAGGGATGCTATGTGCC -3'
(R):5'- AGGACCCTTTACAGTTCTCCCACAG -3'

Sequencing Primer
(F):5'- CTATGTGCCTGGGGCAGAG -3'
(R):5'- ttctcccacagagcccc -3'
Posted On2013-10-16