Incidental Mutation 'R0838:Ap5s1'
ID78025
Institutional Source Beutler Lab
Gene Symbol Ap5s1
Ensembl Gene ENSMUSG00000068264
Gene Nameadaptor-related protein 5 complex, sigma 1 subunit
Synonyms
MMRRC Submission 039017-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0838 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location131207078-131213514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 131211431 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 45 (R45K)
Ref Sequence ENSEMBL: ENSMUSP00000105839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089506] [ENSMUST00000110206] [ENSMUST00000110208] [ENSMUST00000110210] [ENSMUST00000153097]
Predicted Effect probably damaging
Transcript: ENSMUST00000089506
AA Change: R45K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000086933
Gene: ENSMUSG00000068264
AA Change: R45K

DomainStartEndE-ValueType
Pfam:AP-5_subunit_s1 1 162 1.2e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110206
AA Change: R45K

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105835
Gene: ENSMUSG00000068264
AA Change: R45K

DomainStartEndE-ValueType
Pfam:AP-5_subunit_s1 1 68 3.6e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110208
AA Change: R45K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105837
Gene: ENSMUSG00000068264
AA Change: R45K

DomainStartEndE-ValueType
Pfam:AP-5_subunit_s1 1 195 6.7e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110210
AA Change: R45K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105839
Gene: ENSMUSG00000068264
AA Change: R45K

DomainStartEndE-ValueType
Pfam:AP-5_subunit_s1 1 162 8.2e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143546
Predicted Effect probably benign
Transcript: ENSMUST00000153097
SMART Domains Protein: ENSMUSP00000121488
Gene: ENSMUSG00000068264

DomainStartEndE-ValueType
Pfam:AP-5_subunit_s1 1 99 6.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153901
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,468 S513P possibly damaging Het
2310057M21Rik T A 7: 131,361,806 M53L probably damaging Het
Adamts6 A G 13: 104,413,789 N638D possibly damaging Het
Amy2b T C 3: 113,151,001 noncoding transcript Het
Arap1 T C 7: 101,400,412 Y994H probably damaging Het
Arrdc3 A T 13: 80,889,247 probably benign Het
Bard1 G A 1: 71,030,653 T722M probably damaging Het
Ccdc88a A G 11: 29,400,285 Y89C probably damaging Het
Cd96 A G 16: 46,117,926 S59P probably damaging Het
Chit1 T A 1: 134,143,337 C51* probably null Het
Cilp2 G T 8: 69,881,719 H876Q probably benign Het
Cyld A G 8: 88,741,350 E722G probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dedd2 T C 7: 25,211,187 E188G probably benign Het
Dnah17 A T 11: 118,060,104 W2898R probably damaging Het
Dpy19l1 T C 9: 24,432,431 T473A probably damaging Het
Fam228a T A 12: 4,735,002 H43L possibly damaging Het
Fkbp15 G T 4: 62,324,126 H530N probably damaging Het
Gga1 C T 15: 78,891,918 S387L probably damaging Het
Gm14124 T A 2: 150,269,300 C637S possibly damaging Het
Gm4868 A G 5: 125,848,623 noncoding transcript Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Itgb4 A C 11: 115,998,162 probably benign Het
Jag1 G A 2: 137,093,278 T388I probably damaging Het
Kcnh1 A G 1: 192,413,206 D551G probably damaging Het
Lrp2bp A G 8: 46,025,124 D270G possibly damaging Het
Map3k19 C A 1: 127,823,959 V552F probably benign Het
Mixl1 A T 1: 180,696,800 D71E probably benign Het
Myocd A G 11: 65,178,932 I694T probably benign Het
Nadk2 T A 15: 9,091,242 S198T probably benign Het
Npepps A T 11: 97,267,692 probably benign Het
Nt5c1b C T 12: 10,375,071 Q206* probably null Het
Olfr64 T A 7: 103,893,415 I107F probably benign Het
Orm1 A G 4: 63,345,157 Y69C probably damaging Het
Plscr4 T A 9: 92,471,760 probably benign Het
Pon1 G A 6: 5,175,758 T188I possibly damaging Het
Ppm1a T A 12: 72,784,320 H206Q probably benign Het
Prl8a1 G A 13: 27,574,025 R234C probably damaging Het
Rfx3 C T 19: 27,849,967 R73Q possibly damaging Het
Rims2 T C 15: 39,681,025 V1466A probably benign Het
Sec24d T A 3: 123,305,836 F319L probably benign Het
Slc15a4 A G 5: 127,617,003 S123P possibly damaging Het
Slc1a6 A T 10: 78,796,222 D294V probably damaging Het
Slc28a3 A T 13: 58,588,269 D38E probably benign Het
Stard3nl A G 13: 19,372,586 probably null Het
Stard9 A G 2: 120,700,842 T2527A probably damaging Het
Sult3a1 C T 10: 33,879,288 P283L probably damaging Het
Tgtp1 A G 11: 48,987,143 V245A probably benign Het
Txndc16 T C 14: 45,165,419 probably benign Het
Zdhhc8 A G 16: 18,224,566 L590S probably damaging Het
Zfp366 A G 13: 99,228,610 E93G possibly damaging Het
Zfp69 T C 4: 120,931,281 N279S probably benign Het
Zscan10 T C 17: 23,610,034 S407P possibly damaging Het
Other mutations in Ap5s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01715:Ap5s1 APN 2 131211373 missense probably damaging 1.00
IGL02216:Ap5s1 APN 2 131212967 unclassified probably benign
R6018:Ap5s1 UTSW 2 131212995 nonsense probably null
R7035:Ap5s1 UTSW 2 131212812 missense probably damaging 1.00
R7348:Ap5s1 UTSW 2 131212652 missense possibly damaging 0.58
R7356:Ap5s1 UTSW 2 131212662 missense probably damaging 1.00
R7585:Ap5s1 UTSW 2 131212562 missense probably damaging 0.99
R7683:Ap5s1 UTSW 2 131212707 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGCAGAGCAGGCACTAGATTATTCAG -3'
(R):5'- AATTCCCAGAACATATTCCCAGTGCAG -3'

Sequencing Primer
(F):5'- AGCAGGGGATTCACTTTCAC -3'
(R):5'- GAACATATTCCCAGTGCAGTAAATAC -3'
Posted On2013-10-16