Incidental Mutation 'R0838:Guk1'
ID78052
Institutional Source Beutler Lab
Gene Symbol Guk1
Ensembl Gene ENSMUSG00000020444
Gene Nameguanylate kinase 1
Synonyms
MMRRC Submission 039017-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R0838 (G1)
Quality Score209
Status Validated
Chromosome11
Chromosomal Location59183875-59192212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59185095 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 146 (R146C)
Ref Sequence ENSEMBL: ENSMUSP00000130214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108790] [ENSMUST00000108793] [ENSMUST00000170202] [ENSMUST00000170895] [ENSMUST00000172714]
Predicted Effect probably benign
Transcript: ENSMUST00000108790
SMART Domains Protein: ENSMUSP00000104418
Gene: ENSMUSG00000043448

DomainStartEndE-ValueType
CNX 45 78 3.37e-17 SMART
low complexity region 101 127 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 143 193 N/A INTRINSIC
Connexin_CCC 222 288 9.88e-42 SMART
low complexity region 298 330 N/A INTRINSIC
low complexity region 347 372 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108793
SMART Domains Protein: ENSMUSP00000104421
Gene: ENSMUSG00000043448

DomainStartEndE-ValueType
CNX 45 78 3.37e-17 SMART
low complexity region 101 127 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 143 193 N/A INTRINSIC
Connexin_CCC 222 288 9.88e-42 SMART
low complexity region 298 330 N/A INTRINSIC
low complexity region 347 372 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154386
Predicted Effect probably damaging
Transcript: ENSMUST00000170202
AA Change: R158C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127566
Gene: ENSMUSG00000020444
AA Change: R158C

DomainStartEndE-ValueType
GuKc 24 210 1.36e-94 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170895
AA Change: R146C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130214
Gene: ENSMUSG00000020444
AA Change: R146C

DomainStartEndE-ValueType
GuKc 12 198 1.36e-94 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172714
Meta Mutation Damage Score 0.5896 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the transfer of a phosphate group from ATP to guanosine monophosphate (GMP) to form guanosine diphosphate (GDP). The encoded protein is thought to be a good target for cancer chemotherapy. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,468 S513P possibly damaging Het
2310057M21Rik T A 7: 131,361,806 M53L probably damaging Het
Adamts6 A G 13: 104,413,789 N638D possibly damaging Het
Amy2b T C 3: 113,151,001 noncoding transcript Het
Ap5s1 G A 2: 131,211,431 R45K probably damaging Het
Arap1 T C 7: 101,400,412 Y994H probably damaging Het
Arrdc3 A T 13: 80,889,247 probably benign Het
Bard1 G A 1: 71,030,653 T722M probably damaging Het
Ccdc88a A G 11: 29,400,285 Y89C probably damaging Het
Cd96 A G 16: 46,117,926 S59P probably damaging Het
Chit1 T A 1: 134,143,337 C51* probably null Het
Cilp2 G T 8: 69,881,719 H876Q probably benign Het
Cyld A G 8: 88,741,350 E722G probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dedd2 T C 7: 25,211,187 E188G probably benign Het
Dnah17 A T 11: 118,060,104 W2898R probably damaging Het
Dpy19l1 T C 9: 24,432,431 T473A probably damaging Het
Fam228a T A 12: 4,735,002 H43L possibly damaging Het
Fkbp15 G T 4: 62,324,126 H530N probably damaging Het
Gga1 C T 15: 78,891,918 S387L probably damaging Het
Gm14124 T A 2: 150,269,300 C637S possibly damaging Het
Gm4868 A G 5: 125,848,623 noncoding transcript Het
Itgb4 A C 11: 115,998,162 probably benign Het
Jag1 G A 2: 137,093,278 T388I probably damaging Het
Kcnh1 A G 1: 192,413,206 D551G probably damaging Het
Lrp2bp A G 8: 46,025,124 D270G possibly damaging Het
Map3k19 C A 1: 127,823,959 V552F probably benign Het
Mixl1 A T 1: 180,696,800 D71E probably benign Het
Myocd A G 11: 65,178,932 I694T probably benign Het
Nadk2 T A 15: 9,091,242 S198T probably benign Het
Npepps A T 11: 97,267,692 probably benign Het
Nt5c1b C T 12: 10,375,071 Q206* probably null Het
Olfr64 T A 7: 103,893,415 I107F probably benign Het
Orm1 A G 4: 63,345,157 Y69C probably damaging Het
Plscr4 T A 9: 92,471,760 probably benign Het
Pon1 G A 6: 5,175,758 T188I possibly damaging Het
Ppm1a T A 12: 72,784,320 H206Q probably benign Het
Prl8a1 G A 13: 27,574,025 R234C probably damaging Het
Rfx3 C T 19: 27,849,967 R73Q possibly damaging Het
Rims2 T C 15: 39,681,025 V1466A probably benign Het
Sec24d T A 3: 123,305,836 F319L probably benign Het
Slc15a4 A G 5: 127,617,003 S123P possibly damaging Het
Slc1a6 A T 10: 78,796,222 D294V probably damaging Het
Slc28a3 A T 13: 58,588,269 D38E probably benign Het
Stard3nl A G 13: 19,372,586 probably null Het
Stard9 A G 2: 120,700,842 T2527A probably damaging Het
Sult3a1 C T 10: 33,879,288 P283L probably damaging Het
Tgtp1 A G 11: 48,987,143 V245A probably benign Het
Txndc16 T C 14: 45,165,419 probably benign Het
Zdhhc8 A G 16: 18,224,566 L590S probably damaging Het
Zfp366 A G 13: 99,228,610 E93G possibly damaging Het
Zfp69 T C 4: 120,931,281 N279S probably benign Het
Zscan10 T C 17: 23,610,034 S407P possibly damaging Het
Other mutations in Guk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0254:Guk1 UTSW 11 59186028 missense probably damaging 0.96
R0839:Guk1 UTSW 11 59185095 missense probably damaging 1.00
R0840:Guk1 UTSW 11 59185095 missense probably damaging 1.00
R1586:Guk1 UTSW 11 59186849 missense probably damaging 1.00
R1729:Guk1 UTSW 11 59185312 missense probably damaging 1.00
R1784:Guk1 UTSW 11 59185312 missense probably damaging 1.00
R1795:Guk1 UTSW 11 59186813 missense probably benign 0.05
R7411:Guk1 UTSW 11 59185985 missense
R7446:Guk1 UTSW 11 59186024 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGAATGTGGACCAAGCTCAGACCC -3'
(R):5'- AGTTTCTCTGAAGCTCTCGAAAGCC -3'

Sequencing Primer
(F):5'- TCAGTAAACAAGTGTGGCCTCTC -3'
(R):5'- TCCCAGCAAGGAAGCTGTTC -3'
Posted On2013-10-16