Incidental Mutation 'R0838:Ppm1a'
ID78059
Institutional Source Beutler Lab
Gene Symbol Ppm1a
Ensembl Gene ENSMUSG00000021096
Gene Nameprotein phosphatase 1A, magnesium dependent, alpha isoform
Synonyms2900017D14Rik, MMPa-2, MPPa-1, 2310003C21Rik, Mpp alpha
MMRRC Submission 039017-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0838 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location72757455-72799819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72784320 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 206 (H206Q)
Ref Sequence ENSEMBL: ENSMUSP00000021514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021514] [ENSMUST00000221502] [ENSMUST00000221628] [ENSMUST00000222790] [ENSMUST00000222896]
Predicted Effect probably benign
Transcript: ENSMUST00000021514
AA Change: H206Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021514
Gene: ENSMUSG00000021096
AA Change: H206Q

DomainStartEndE-ValueType
PP2Cc 13 289 5.08e-106 SMART
PP2C_SIG 38 291 1.26e-1 SMART
Blast:PP2Cc 295 335 6e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000221502
Predicted Effect probably benign
Transcript: ENSMUST00000221628
Predicted Effect probably benign
Transcript: ENSMUST00000222790
Predicted Effect probably benign
Transcript: ENSMUST00000222896
AA Change: H206Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223410
Meta Mutation Damage Score 0.0687 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase dephosphorylates, and negatively regulates the activities of, MAP kinases and MAP kinase kinases. It has been shown to inhibit the activation of p38 and JNK kinase cascades induced by environmental stresses. This phosphatase can also dephosphorylate cyclin-dependent kinases, and thus may be involved in cell cycle control. Overexpression of this phosphatase is reported to activate the expression of the tumor suppressor gene TP53/p53, which leads to G2/M cell cycle arrest and apoptosis. Three alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit delayed wound healing, delayed re-epithelialization, and decreased keratinocyte migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,468 S513P possibly damaging Het
2310057M21Rik T A 7: 131,361,806 M53L probably damaging Het
Adamts6 A G 13: 104,413,789 N638D possibly damaging Het
Amy2b T C 3: 113,151,001 noncoding transcript Het
Ap5s1 G A 2: 131,211,431 R45K probably damaging Het
Arap1 T C 7: 101,400,412 Y994H probably damaging Het
Arrdc3 A T 13: 80,889,247 probably benign Het
Bard1 G A 1: 71,030,653 T722M probably damaging Het
Ccdc88a A G 11: 29,400,285 Y89C probably damaging Het
Cd96 A G 16: 46,117,926 S59P probably damaging Het
Chit1 T A 1: 134,143,337 C51* probably null Het
Cilp2 G T 8: 69,881,719 H876Q probably benign Het
Cyld A G 8: 88,741,350 E722G probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dedd2 T C 7: 25,211,187 E188G probably benign Het
Dnah17 A T 11: 118,060,104 W2898R probably damaging Het
Dpy19l1 T C 9: 24,432,431 T473A probably damaging Het
Fam228a T A 12: 4,735,002 H43L possibly damaging Het
Fkbp15 G T 4: 62,324,126 H530N probably damaging Het
Gga1 C T 15: 78,891,918 S387L probably damaging Het
Gm14124 T A 2: 150,269,300 C637S possibly damaging Het
Gm4868 A G 5: 125,848,623 noncoding transcript Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Itgb4 A C 11: 115,998,162 probably benign Het
Jag1 G A 2: 137,093,278 T388I probably damaging Het
Kcnh1 A G 1: 192,413,206 D551G probably damaging Het
Lrp2bp A G 8: 46,025,124 D270G possibly damaging Het
Map3k19 C A 1: 127,823,959 V552F probably benign Het
Mixl1 A T 1: 180,696,800 D71E probably benign Het
Myocd A G 11: 65,178,932 I694T probably benign Het
Nadk2 T A 15: 9,091,242 S198T probably benign Het
Npepps A T 11: 97,267,692 probably benign Het
Nt5c1b C T 12: 10,375,071 Q206* probably null Het
Olfr64 T A 7: 103,893,415 I107F probably benign Het
Orm1 A G 4: 63,345,157 Y69C probably damaging Het
Plscr4 T A 9: 92,471,760 probably benign Het
Pon1 G A 6: 5,175,758 T188I possibly damaging Het
Prl8a1 G A 13: 27,574,025 R234C probably damaging Het
Rfx3 C T 19: 27,849,967 R73Q possibly damaging Het
Rims2 T C 15: 39,681,025 V1466A probably benign Het
Sec24d T A 3: 123,305,836 F319L probably benign Het
Slc15a4 A G 5: 127,617,003 S123P possibly damaging Het
Slc1a6 A T 10: 78,796,222 D294V probably damaging Het
Slc28a3 A T 13: 58,588,269 D38E probably benign Het
Stard3nl A G 13: 19,372,586 probably null Het
Stard9 A G 2: 120,700,842 T2527A probably damaging Het
Sult3a1 C T 10: 33,879,288 P283L probably damaging Het
Tgtp1 A G 11: 48,987,143 V245A probably benign Het
Txndc16 T C 14: 45,165,419 probably benign Het
Zdhhc8 A G 16: 18,224,566 L590S probably damaging Het
Zfp366 A G 13: 99,228,610 E93G possibly damaging Het
Zfp69 T C 4: 120,931,281 N279S probably benign Het
Zscan10 T C 17: 23,610,034 S407P possibly damaging Het
Other mutations in Ppm1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1305:Ppm1a UTSW 12 72783720 missense probably damaging 1.00
R1802:Ppm1a UTSW 12 72793707 splice site probably null
R4864:Ppm1a UTSW 12 72783964 missense probably benign
R4895:Ppm1a UTSW 12 72784352 missense probably damaging 1.00
R5604:Ppm1a UTSW 12 72790681 missense probably benign 0.22
R6348:Ppm1a UTSW 12 72790675 missense probably benign
R7130:Ppm1a UTSW 12 72784233 missense probably benign 0.01
R7432:Ppm1a UTSW 12 72784142 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGGTTCTCAGGTTGCCAAATAC -3'
(R):5'- GGCTACCTTATACAAGCAGGTGTCG -3'

Sequencing Primer
(F):5'- CAGGTTGCCAAATACTGCTG -3'
(R):5'- GCAAACTTTCTCAAGGTCATCAGTG -3'
Posted On2013-10-16