Mutagenetix > Incidental Mutations

Incidental Mutation 'R0839:Lct'

78075

Institutional Source

Beutler Lab

Gene Symbol

Lct

Ensembl Gene

ENSMUSG00000026354

Gene Name

lactase

Synonyms

LPH, LOC226413, Lphl

MMRRC Submission

039018-MU

Accession Numbers

Genbank: NM_001081078; MGI:104576

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0839 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128284756-128328318 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 128286609 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 1809 (A1809T)

Ref Sequence

ENSEMBL: ENSMUSP00000073190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073490]

Predicted Effect

probably benign
Transcript: ENSMUST00000073490
AA Change: A1809T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: A1809T

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	76	226	1.6e-19	PFAM
low complexity region	322	340	N/A	INTRINSIC
Pfam:Glyco_hydro_1	380	849	4.8e-169	PFAM
low complexity region	865	875	N/A	INTRINSIC
Pfam:Glyco_hydro_1	902	1368	3.7e-181	PFAM
Pfam:Glyco_hydro_1	1377	1844	6.9e-183	PFAM
transmembrane domain	1885	1907	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162067

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	G	A	3: 122,126,878	V1083M	probably damaging	Het
Aco2	A	G	15: 81,907,535		probably null	Het
AI661453	A	T	17: 47,436,827	Q8L	probably null	Het
Ankrd42	T	C	7: 92,612,772	D295G	possibly damaging	Het
Ccdc73	A	T	2: 104,991,097	I464L	probably benign	Het
Cdc5l	A	C	17: 45,393,147	M717R	probably benign	Het
Col4a1	G	A	8: 11,221,015	P809S	probably damaging	Het
Dctn1	T	C	6: 83,190,477	M358T	possibly damaging	Het
Dgkz	A	G	2: 91,935,111	S799P	probably benign	Het
Dna2	T	C	10: 62,969,782	C933R	probably damaging	Het
Dock6	T	C	9: 21,817,892	N1275S	probably benign	Het
Ect2l	A	G	10: 18,141,904	I659T	probably benign	Het
Ets1	T	A	9: 32,734,061	Y201*	probably null	Het
Gle1	T	A	2: 29,958,450	C679S	probably benign	Het
Gm10118	T	G	10: 63,926,864		probably benign	Het
Guk1	G	A	11: 59,185,095	R146C	probably damaging	Het
H2-Q7	A	G	17: 35,439,712	S109G	probably damaging	Het
Igfn1	A	G	1: 135,954,680	V2809A	probably damaging	Het
Izumo1	T	A	7: 45,627,112	D366E	probably benign	Het
Kctd20	A	T	17: 28,957,898	M1L	possibly damaging	Het
Manea	T	C	4: 26,327,983	I353V	probably damaging	Het
Mybl2	T	C	2: 163,075,768	Y65H	probably benign	Het
Myh11	C	T	16: 14,203,178	E1744K	probably damaging	Het
Neb	T	C	2: 52,277,548	D1922G	probably damaging	Het
Nepro	C	A	16: 44,736,019	D513E	probably benign	Het
Nnt	A	T	13: 119,394,656	I185K	possibly damaging	Het
Npat	A	T	9: 53,545,180	Q17L	probably damaging	Het
Nup155	A	G	15: 8,145,587	E956G	possibly damaging	Het
Olfr1375	A	G	11: 51,048,427	I107V	probably benign	Het
Olfr1537	A	T	9: 39,237,850	N191K	possibly damaging	Het
Olfr237-ps1	T	A	6: 43,153,624	F106L	probably benign	Het
Olfr311	G	A	11: 58,841,652	M179I	probably benign	Het
Olfr395	T	A	11: 73,907,312	Y60F	probably damaging	Het
Olfr735	A	G	14: 50,346,088	V118A	probably damaging	Het
Olfr967	A	T	9: 39,750,391	I2L	probably benign	Het
Pah	T	C	10: 87,522,062	S16P	probably damaging	Het
Pcdh15	C	A	10: 74,626,782	P1365Q	probably null	Het
Pds5b	G	T	5: 150,764,962	V640F	probably benign	Het
Pgam5	A	T	5: 110,267,130	H72Q	probably benign	Het
Plagl2	C	A	2: 153,232,541	A147S	probably damaging	Het
Ppfia4	A	T	1: 134,328,807	L113Q	probably null	Het
Ppp1r12a	T	C	10: 108,198,861	V89A	probably damaging	Het
Ptprc	A	G	1: 138,101,132	Y443H	possibly damaging	Het
Ralgapb	T	C	2: 158,473,283		probably null	Het
Rgsl1	A	G	1: 153,802,234		probably null	Het
Rubcn	A	C	16: 32,827,343	I681M	probably damaging	Het
Scaf11	A	G	15: 96,423,553	L169S	probably damaging	Het
Scgb1b27	A	G	7: 34,021,851	K55E	probably benign	Het
Sos1	A	T	17: 80,433,730	I542N	probably damaging	Het
Syf2	T	A	4: 134,936,063	V182D	probably damaging	Het
Tapbp	T	C	17: 33,925,743	V271A	probably benign	Het
Tmem33	T	A	5: 67,264,308	L60Q	probably damaging	Het
Tmf1	A	G	6: 97,176,323	V263A	probably damaging	Het
Vps13c	T	C	9: 67,898,738	V798A	probably benign	Het
Zfp384	C	A	6: 125,036,668	D550E	probably benign	Het

Other mutations in Lct

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Lct	APN	1	128287556	missense	probably benign	0.09
IGL00970:Lct	APN	1	128304068	missense	probably damaging	1.00
IGL01022:Lct	APN	1	128300859	missense	probably benign
IGL01878:Lct	APN	1	128294266	missense	probably damaging	1.00
IGL01892:Lct	APN	1	128307605	missense	probably damaging	1.00
IGL02307:Lct	APN	1	128286590	missense	possibly damaging	0.70
IGL02434:Lct	APN	1	128303790	missense	probably damaging	0.97
IGL02559:Lct	APN	1	128294266	missense	probably damaging	1.00
IGL02623:Lct	APN	1	128308251	missense	probably benign	0.01
IGL02818:Lct	APN	1	128300168	missense	probably damaging	1.00
IGL02949:Lct	APN	1	128313132	missense	probably benign	0.26
IGL02951:Lct	APN	1	128300211	missense	probably damaging	1.00
IGL03087:Lct	APN	1	128300375	missense	possibly damaging	0.81
IGL03227:Lct	APN	1	128327689	missense	probably benign	0.09
ANU18:Lct	UTSW	1	128308047	nonsense	probably null
R0071:Lct	UTSW	1	128292018	nonsense	probably null
R0071:Lct	UTSW	1	128292018	nonsense	probably null
R0135:Lct	UTSW	1	128285123	missense	probably damaging	0.98
R0145:Lct	UTSW	1	128327895	missense	probably benign	0.00
R0179:Lct	UTSW	1	128327685	missense	probably benign
R0331:Lct	UTSW	1	128298742	splice site	probably benign
R0366:Lct	UTSW	1	128286462	missense	probably benign	0.03
R0399:Lct	UTSW	1	128300525	missense	probably damaging	1.00
R0492:Lct	UTSW	1	128300582	missense	probably damaging	1.00
R0548:Lct	UTSW	1	128285195	missense	probably damaging	1.00
R0691:Lct	UTSW	1	128308234	missense	probably benign	0.00
R0755:Lct	UTSW	1	128294135	missense	possibly damaging	0.46
R1128:Lct	UTSW	1	128301309	missense	probably damaging	0.99
R1135:Lct	UTSW	1	128294124	critical splice donor site	probably null
R1321:Lct	UTSW	1	128300022	missense	probably benign
R1448:Lct	UTSW	1	128307822	missense	probably damaging	0.99
R1450:Lct	UTSW	1	128307903	missense	probably damaging	1.00
R1572:Lct	UTSW	1	128294195	missense	probably benign	0.25
R1582:Lct	UTSW	1	128300562	missense	probably damaging	1.00
R1668:Lct	UTSW	1	128287722	splice site	probably null
R1757:Lct	UTSW	1	128301257	missense	probably damaging	1.00
R1775:Lct	UTSW	1	128300301	missense	probably damaging	1.00
R1792:Lct	UTSW	1	128327942	missense	possibly damaging	0.54
R1815:Lct	UTSW	1	128300159	missense	probably damaging	1.00
R1932:Lct	UTSW	1	128294161	missense	probably damaging	1.00
R2325:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R2381:Lct	UTSW	1	128304121	nonsense	probably null
R3001:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3002:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3003:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3011:Lct	UTSW	1	128301372	missense	possibly damaging	0.74
R3082:Lct	UTSW	1	128287608	missense	probably damaging	1.00
R3683:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3684:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3726:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3886:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3887:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3888:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4019:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4027:Lct	UTSW	1	128285181	missense	probably benign	0.00
R4226:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4409:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4514:Lct	UTSW	1	128300514	missense	probably benign
R4570:Lct	UTSW	1	128299904	missense	probably benign	0.01
R4776:Lct	UTSW	1	128300387	missense	probably damaging	0.99
R5001:Lct	UTSW	1	128308241	missense	probably damaging	0.96
R5021:Lct	UTSW	1	128300565	missense	probably benign	0.38
R5318:Lct	UTSW	1	128304372	missense	probably damaging	1.00
R5330:Lct	UTSW	1	128298529	missense	probably benign	0.06
R5385:Lct	UTSW	1	128311617	missense	possibly damaging	0.63
R5499:Lct	UTSW	1	128286677	missense	probably damaging	1.00
R5508:Lct	UTSW	1	128294131	missense	probably damaging	1.00
R5642:Lct	UTSW	1	128295232	missense	probably damaging	1.00
R5724:Lct	UTSW	1	128300336	missense	probably benign
R6026:Lct	UTSW	1	128300018	missense	probably benign
R6044:Lct	UTSW	1	128307980	missense	possibly damaging	0.95
R6175:Lct	UTSW	1	128327714	missense	probably damaging	1.00
R6277:Lct	UTSW	1	128304237	missense	probably benign	0.01
R6412:Lct	UTSW	1	128327718	missense	probably benign	0.00
R6480:Lct	UTSW	1	128294320	missense	probably damaging	1.00
R6526:Lct	UTSW	1	128300478	missense	probably benign	0.05
R6620:Lct	UTSW	1	128295072	critical splice donor site	probably null
R7214:Lct	UTSW	1	128300460	missense	probably benign	0.00
R7308:Lct	UTSW	1	128319087	missense	probably benign	0.00
R7577:Lct	UTSW	1	128300732	missense	probably damaging	0.99
R7626:Lct	UTSW	1	128285195	missense	probably damaging	1.00
R7737:Lct	UTSW	1	128298693	missense	probably benign	0.12
X0052:Lct	UTSW	1	128307630	missense	probably damaging	1.00
YA93:Lct	UTSW	1	128301320	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACCTTCTGGTTGCTGGAGACAAG -3'
(R):5'- ACACTGATGGCCCTGCATATCCAC -3'

Sequencing Primer
(F):5'- AAGGATGAGGTCCTTGTGC -3'
(R):5'- GGCTCTCAGAGTTGAACTCAC -3'

Posted On

2013-10-16