Incidental Mutation 'R0839:Rgsl1'
ID78079
Institutional Source Beutler Lab
Gene Symbol Rgsl1
Ensembl Gene ENSMUSG00000042641
Gene Nameregulator of G-protein signaling like 1
SynonymsRgsl2, 4930415K13Rik
MMRRC Submission 039018-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0839 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location153779381-153844142 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 153802234 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000124558] [ENSMUST00000124558] [ENSMUST00000124558] [ENSMUST00000141249] [ENSMUST00000141249] [ENSMUST00000185164] [ENSMUST00000185164]
Predicted Effect probably null
Transcript: ENSMUST00000124558
SMART Domains Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641

DomainStartEndE-ValueType
low complexity region 122 136 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
Pfam:RGS 644 754 7.1e-12 PFAM
transmembrane domain 956 973 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124558
SMART Domains Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641

DomainStartEndE-ValueType
low complexity region 122 136 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
Pfam:RGS 644 754 7.1e-12 PFAM
transmembrane domain 956 973 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124558
SMART Domains Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641

DomainStartEndE-ValueType
low complexity region 122 136 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
Pfam:RGS 644 754 7.1e-12 PFAM
transmembrane domain 956 973 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124558
SMART Domains Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641

DomainStartEndE-ValueType
low complexity region 122 136 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
Pfam:RGS 644 754 7.1e-12 PFAM
transmembrane domain 956 973 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134030
Predicted Effect probably null
Transcript: ENSMUST00000141249
SMART Domains Protein: ENSMUSP00000139215
Gene: ENSMUSG00000042641

DomainStartEndE-ValueType
Blast:RGS 3 300 3e-30 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000141249
SMART Domains Protein: ENSMUSP00000139215
Gene: ENSMUSG00000042641

DomainStartEndE-ValueType
Blast:RGS 3 300 3e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184095
Predicted Effect probably benign
Transcript: ENSMUST00000184095
Predicted Effect probably benign
Transcript: ENSMUST00000185164
SMART Domains Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641

DomainStartEndE-ValueType
low complexity region 157 171 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 351 360 N/A INTRINSIC
Pfam:RGS 679 789 4.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185164
SMART Domains Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641

DomainStartEndE-ValueType
low complexity region 157 171 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 351 360 N/A INTRINSIC
Pfam:RGS 679 789 4.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206321
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,126,878 V1083M probably damaging Het
Aco2 A G 15: 81,907,535 probably null Het
AI661453 A T 17: 47,436,827 Q8L probably null Het
Ankrd42 T C 7: 92,612,772 D295G possibly damaging Het
Ccdc73 A T 2: 104,991,097 I464L probably benign Het
Cdc5l A C 17: 45,393,147 M717R probably benign Het
Col4a1 G A 8: 11,221,015 P809S probably damaging Het
Dctn1 T C 6: 83,190,477 M358T possibly damaging Het
Dgkz A G 2: 91,935,111 S799P probably benign Het
Dna2 T C 10: 62,969,782 C933R probably damaging Het
Dock6 T C 9: 21,817,892 N1275S probably benign Het
Ect2l A G 10: 18,141,904 I659T probably benign Het
Ets1 T A 9: 32,734,061 Y201* probably null Het
Gle1 T A 2: 29,958,450 C679S probably benign Het
Gm10118 T G 10: 63,926,864 probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
H2-Q7 A G 17: 35,439,712 S109G probably damaging Het
Igfn1 A G 1: 135,954,680 V2809A probably damaging Het
Izumo1 T A 7: 45,627,112 D366E probably benign Het
Kctd20 A T 17: 28,957,898 M1L possibly damaging Het
Lct C T 1: 128,286,609 A1809T probably benign Het
Manea T C 4: 26,327,983 I353V probably damaging Het
Mybl2 T C 2: 163,075,768 Y65H probably benign Het
Myh11 C T 16: 14,203,178 E1744K probably damaging Het
Neb T C 2: 52,277,548 D1922G probably damaging Het
Nepro C A 16: 44,736,019 D513E probably benign Het
Nnt A T 13: 119,394,656 I185K possibly damaging Het
Npat A T 9: 53,545,180 Q17L probably damaging Het
Nup155 A G 15: 8,145,587 E956G possibly damaging Het
Olfr1375 A G 11: 51,048,427 I107V probably benign Het
Olfr1537 A T 9: 39,237,850 N191K possibly damaging Het
Olfr237-ps1 T A 6: 43,153,624 F106L probably benign Het
Olfr311 G A 11: 58,841,652 M179I probably benign Het
Olfr395 T A 11: 73,907,312 Y60F probably damaging Het
Olfr735 A G 14: 50,346,088 V118A probably damaging Het
Olfr967 A T 9: 39,750,391 I2L probably benign Het
Pah T C 10: 87,522,062 S16P probably damaging Het
Pcdh15 C A 10: 74,626,782 P1365Q probably null Het
Pds5b G T 5: 150,764,962 V640F probably benign Het
Pgam5 A T 5: 110,267,130 H72Q probably benign Het
Plagl2 C A 2: 153,232,541 A147S probably damaging Het
Ppfia4 A T 1: 134,328,807 L113Q probably null Het
Ppp1r12a T C 10: 108,198,861 V89A probably damaging Het
Ptprc A G 1: 138,101,132 Y443H possibly damaging Het
Ralgapb T C 2: 158,473,283 probably null Het
Rubcn A C 16: 32,827,343 I681M probably damaging Het
Scaf11 A G 15: 96,423,553 L169S probably damaging Het
Scgb1b27 A G 7: 34,021,851 K55E probably benign Het
Sos1 A T 17: 80,433,730 I542N probably damaging Het
Syf2 T A 4: 134,936,063 V182D probably damaging Het
Tapbp T C 17: 33,925,743 V271A probably benign Het
Tmem33 T A 5: 67,264,308 L60Q probably damaging Het
Tmf1 A G 6: 97,176,323 V263A probably damaging Het
Vps13c T C 9: 67,898,738 V798A probably benign Het
Zfp384 C A 6: 125,036,668 D550E probably benign Het
Other mutations in Rgsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01372:Rgsl1 APN 1 153826141 missense probably damaging 1.00
IGL02253:Rgsl1 APN 1 153793767 missense probably damaging 1.00
IGL02345:Rgsl1 APN 1 153804009 splice site probably null
IGL02409:Rgsl1 APN 1 153826243 missense possibly damaging 0.53
IGL02587:Rgsl1 APN 1 153799938 missense probably damaging 1.00
IGL02652:Rgsl1 APN 1 153825490 missense probably damaging 1.00
IGL02797:Rgsl1 APN 1 153807708 missense probably damaging 1.00
IGL03032:Rgsl1 APN 1 153826202 missense possibly damaging 0.53
IGL03082:Rgsl1 APN 1 153799947 missense possibly damaging 0.86
IGL03123:Rgsl1 APN 1 153825941 missense probably damaging 1.00
IGL03213:Rgsl1 APN 1 153825841 missense probably benign 0.12
IGL03410:Rgsl1 APN 1 153793755 missense probably null 0.82
IGL03050:Rgsl1 UTSW 1 153825676 missense possibly damaging 0.60
PIT4519001:Rgsl1 UTSW 1 153825970 missense possibly damaging 0.96
R0149:Rgsl1 UTSW 1 153793764 missense probably damaging 1.00
R0536:Rgsl1 UTSW 1 153826181 missense probably damaging 1.00
R0633:Rgsl1 UTSW 1 153844107 missense possibly damaging 0.72
R0726:Rgsl1 UTSW 1 153802328 missense probably damaging 1.00
R1240:Rgsl1 UTSW 1 153785191 missense probably benign 0.18
R1355:Rgsl1 UTSW 1 153807761 start codon destroyed probably null 0.23
R1491:Rgsl1 UTSW 1 153825926 missense possibly damaging 0.93
R1688:Rgsl1 UTSW 1 153804676 missense probably damaging 0.98
R1694:Rgsl1 UTSW 1 153804676 missense probably damaging 0.98
R1842:Rgsl1 UTSW 1 153799797 missense probably damaging 1.00
R2008:Rgsl1 UTSW 1 153825905 missense possibly damaging 0.53
R2114:Rgsl1 UTSW 1 153817549 missense probably benign
R2116:Rgsl1 UTSW 1 153817549 missense probably benign
R2176:Rgsl1 UTSW 1 153825268 splice site probably benign
R2229:Rgsl1 UTSW 1 153822358 missense possibly damaging 0.72
R2895:Rgsl1 UTSW 1 153827548 missense probably damaging 1.00
R3923:Rgsl1 UTSW 1 153804130 critical splice acceptor site probably null
R4001:Rgsl1 UTSW 1 153817584 missense probably damaging 1.00
R4434:Rgsl1 UTSW 1 153802341 missense possibly damaging 0.52
R4489:Rgsl1 UTSW 1 153827536 missense probably benign 0.27
R4649:Rgsl1 UTSW 1 153817582 missense probably benign 0.01
R4925:Rgsl1 UTSW 1 153812277 missense probably benign 0.01
R4928:Rgsl1 UTSW 1 153793768 missense probably damaging 1.00
R5045:Rgsl1 UTSW 1 153821522 nonsense probably null
R5304:Rgsl1 UTSW 1 153827492 missense probably damaging 0.97
R5331:Rgsl1 UTSW 1 153802292 missense probably benign 0.02
R5373:Rgsl1 UTSW 1 153790307 missense probably benign 0.33
R5374:Rgsl1 UTSW 1 153790307 missense probably benign 0.33
R5566:Rgsl1 UTSW 1 153793774 missense probably damaging 1.00
R5649:Rgsl1 UTSW 1 153825893 missense possibly damaging 0.93
R6062:Rgsl1 UTSW 1 153799872 missense possibly damaging 0.72
R6142:Rgsl1 UTSW 1 153812238 missense probably benign 0.01
R6158:Rgsl1 UTSW 1 153804021 missense possibly damaging 0.72
R6184:Rgsl1 UTSW 1 153827448 missense probably benign 0.08
R6273:Rgsl1 UTSW 1 153827465 missense possibly damaging 0.96
R6384:Rgsl1 UTSW 1 153827545 missense possibly damaging 0.86
R6419:Rgsl1 UTSW 1 153822371 missense probably damaging 0.98
R6568:Rgsl1 UTSW 1 153821546 missense possibly damaging 0.72
R6660:Rgsl1 UTSW 1 153825766 missense possibly damaging 0.70
R6745:Rgsl1 UTSW 1 153822317 missense probably benign 0.18
R6892:Rgsl1 UTSW 1 153821499 nonsense probably null
R6974:Rgsl1 UTSW 1 153799822 missense probably damaging 1.00
R7172:Rgsl1 UTSW 1 153826220 missense possibly damaging 0.72
R7200:Rgsl1 UTSW 1 153785199 missense probably benign 0.33
R7275:Rgsl1 UTSW 1 153804130 critical splice acceptor site probably null
R7313:Rgsl1 UTSW 1 153807876 critical splice acceptor site probably null
R7341:Rgsl1 UTSW 1 153793845 missense probably benign 0.01
R7448:Rgsl1 UTSW 1 153844101 critical splice donor site probably null
R7662:Rgsl1 UTSW 1 153825479 missense probably benign
R7703:Rgsl1 UTSW 1 153793864 missense possibly damaging 0.73
R7846:Rgsl1 UTSW 1 153826037 missense possibly damaging 0.53
X0020:Rgsl1 UTSW 1 153825385 missense probably benign 0.33
X0065:Rgsl1 UTSW 1 153804033 missense possibly damaging 0.84
Z1177:Rgsl1 UTSW 1 153817610 missense possibly damaging 0.70
Z1177:Rgsl1 UTSW 1 153825988 missense not run
Predicted Primers PCR Primer
(F):5'- ACTTGCTGGCTCTTTGAGAAGCAC -3'
(R):5'- TGGGTTCCCTCACCCTCAAAATGG -3'

Sequencing Primer
(F):5'- TTTGAGAAGCACCTCTATCCAGG -3'
(R):5'- ATCAGGTTTGTGGCACACAC -3'
Posted On2013-10-16