Incidental Mutation 'R0839:Ccdc73'
ID 78084
Institutional Source Beutler Lab
Gene Symbol Ccdc73
Ensembl Gene ENSMUSG00000045106
Gene Name coiled-coil domain containing 73
Synonyms 2210415I11Rik
MMRRC Submission 039018-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R0839 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 104867805-105017904 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104991097 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 464 (I464L)
Ref Sequence ENSEMBL: ENSMUSP00000106743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111114] [ENSMUST00000151764]
AlphaFold Q8CDM4
Predicted Effect probably benign
Transcript: ENSMUST00000111114
AA Change: I464L

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106743
Gene: ENSMUSG00000045106
AA Change: I464L

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:CCDC73 27 1061 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144358
SMART Domains Protein: ENSMUSP00000114374
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
Pfam:CCDC73 1 182 3.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151764
SMART Domains Protein: ENSMUSP00000120706
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
coiled coil region 48 134 N/A INTRINSIC
coiled coil region 178 381 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,126,878 V1083M probably damaging Het
Aco2 A G 15: 81,907,535 probably null Het
AI661453 A T 17: 47,436,827 Q8L probably null Het
Ankrd42 T C 7: 92,612,772 D295G possibly damaging Het
Cdc5l A C 17: 45,393,147 M717R probably benign Het
Col4a1 G A 8: 11,221,015 P809S probably damaging Het
Dctn1 T C 6: 83,190,477 M358T possibly damaging Het
Dgkz A G 2: 91,935,111 S799P probably benign Het
Dna2 T C 10: 62,969,782 C933R probably damaging Het
Dock6 T C 9: 21,817,892 N1275S probably benign Het
Ect2l A G 10: 18,141,904 I659T probably benign Het
Ets1 T A 9: 32,734,061 Y201* probably null Het
Gle1 T A 2: 29,958,450 C679S probably benign Het
Gm10118 T G 10: 63,926,864 probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
H2-Q7 A G 17: 35,439,712 S109G probably damaging Het
Igfn1 A G 1: 135,954,680 V2809A probably damaging Het
Izumo1 T A 7: 45,627,112 D366E probably benign Het
Kctd20 A T 17: 28,957,898 M1L possibly damaging Het
Lct C T 1: 128,286,609 A1809T probably benign Het
Manea T C 4: 26,327,983 I353V probably damaging Het
Mybl2 T C 2: 163,075,768 Y65H probably benign Het
Myh11 C T 16: 14,203,178 E1744K probably damaging Het
Neb T C 2: 52,277,548 D1922G probably damaging Het
Nepro C A 16: 44,736,019 D513E probably benign Het
Nnt A T 13: 119,394,656 I185K possibly damaging Het
Npat A T 9: 53,545,180 Q17L probably damaging Het
Nup155 A G 15: 8,145,587 E956G possibly damaging Het
Olfr1375 A G 11: 51,048,427 I107V probably benign Het
Olfr1537 A T 9: 39,237,850 N191K possibly damaging Het
Olfr237-ps1 T A 6: 43,153,624 F106L probably benign Het
Olfr311 G A 11: 58,841,652 M179I probably benign Het
Olfr395 T A 11: 73,907,312 Y60F probably damaging Het
Olfr735 A G 14: 50,346,088 V118A probably damaging Het
Olfr967 A T 9: 39,750,391 I2L probably benign Het
Pah T C 10: 87,522,062 S16P probably damaging Het
Pcdh15 C A 10: 74,626,782 P1365Q probably null Het
Pds5b G T 5: 150,764,962 V640F probably benign Het
Pgam5 A T 5: 110,267,130 H72Q probably benign Het
Plagl2 C A 2: 153,232,541 A147S probably damaging Het
Ppfia4 A T 1: 134,328,807 L113Q probably null Het
Ppp1r12a T C 10: 108,198,861 V89A probably damaging Het
Ptprc A G 1: 138,101,132 Y443H possibly damaging Het
Ralgapb T C 2: 158,473,283 probably null Het
Rgsl1 A G 1: 153,802,234 probably null Het
Rubcn A C 16: 32,827,343 I681M probably damaging Het
Scaf11 A G 15: 96,423,553 L169S probably damaging Het
Scgb1b27 A G 7: 34,021,851 K55E probably benign Het
Sos1 A T 17: 80,433,730 I542N probably damaging Het
Syf2 T A 4: 134,936,063 V182D probably damaging Het
Tapbp T C 17: 33,925,743 V271A probably benign Het
Tmem33 T A 5: 67,264,308 L60Q probably damaging Het
Tmf1 A G 6: 97,176,323 V263A probably damaging Het
Vps13c T C 9: 67,898,738 V798A probably benign Het
Zfp384 C A 6: 125,036,668 D550E probably benign Het
Other mutations in Ccdc73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Ccdc73 APN 2 104994591 missense probably damaging 1.00
IGL01313:Ccdc73 APN 2 104907627 missense probably benign 0.00
IGL02016:Ccdc73 APN 2 104975616 missense probably benign 0.05
IGL02179:Ccdc73 APN 2 104907568 missense probably damaging 0.99
FR4304:Ccdc73 UTSW 2 104991840 unclassified probably benign
FR4737:Ccdc73 UTSW 2 104991840 unclassified probably benign
IGL03052:Ccdc73 UTSW 2 104951936 missense possibly damaging 0.78
R0010:Ccdc73 UTSW 2 104980987 splice site probably benign
R0040:Ccdc73 UTSW 2 104992084 missense probably damaging 1.00
R0052:Ccdc73 UTSW 2 104929570 splice site probably benign
R0360:Ccdc73 UTSW 2 104981007 missense probably damaging 1.00
R0401:Ccdc73 UTSW 2 104991289 missense probably benign 0.01
R0715:Ccdc73 UTSW 2 104973154 splice site probably benign
R1129:Ccdc73 UTSW 2 104992190 missense possibly damaging 0.51
R1240:Ccdc73 UTSW 2 104991561 missense probably benign 0.05
R1478:Ccdc73 UTSW 2 104907610 missense possibly damaging 0.72
R1478:Ccdc73 UTSW 2 104914667 missense possibly damaging 0.93
R1695:Ccdc73 UTSW 2 104992105 missense probably damaging 1.00
R1924:Ccdc73 UTSW 2 104992292 missense probably damaging 1.00
R1950:Ccdc73 UTSW 2 104926935 missense probably benign 0.01
R1987:Ccdc73 UTSW 2 104931045 nonsense probably null
R1987:Ccdc73 UTSW 2 104999159 missense probably damaging 1.00
R2938:Ccdc73 UTSW 2 104975635 nonsense probably null
R3420:Ccdc73 UTSW 2 104951947 missense probably null 1.00
R3420:Ccdc73 UTSW 2 104951948 splice site probably null
R3422:Ccdc73 UTSW 2 104951947 missense probably null 1.00
R3422:Ccdc73 UTSW 2 104951948 splice site probably null
R3522:Ccdc73 UTSW 2 104991485 missense probably damaging 1.00
R3886:Ccdc73 UTSW 2 104991343 missense possibly damaging 0.94
R4279:Ccdc73 UTSW 2 104985010 missense possibly damaging 0.87
R4791:Ccdc73 UTSW 2 104981105 splice site probably null
R4793:Ccdc73 UTSW 2 105017782 splice site probably null
R4939:Ccdc73 UTSW 2 104992157 splice site probably null
R4950:Ccdc73 UTSW 2 104992366 missense probably benign
R5093:Ccdc73 UTSW 2 105017766 utr 3 prime probably benign
R5150:Ccdc73 UTSW 2 104992039 missense probably benign 0.00
R5381:Ccdc73 UTSW 2 104989925 missense probably damaging 1.00
R5738:Ccdc73 UTSW 2 104930986 missense possibly damaging 0.78
R6148:Ccdc73 UTSW 2 104992137 missense possibly damaging 0.58
R6269:Ccdc73 UTSW 2 104907633 missense probably damaging 1.00
R6738:Ccdc73 UTSW 2 104992088 missense probably benign 0.00
R6753:Ccdc73 UTSW 2 104991524 nonsense probably null
R7062:Ccdc73 UTSW 2 104951878 missense probably damaging 1.00
R7110:Ccdc73 UTSW 2 104973224 missense probably benign 0.21
R7320:Ccdc73 UTSW 2 104999176 missense possibly damaging 0.47
R7436:Ccdc73 UTSW 2 104951869 missense probably damaging 1.00
R7530:Ccdc73 UTSW 2 104994570 missense
R7747:Ccdc73 UTSW 2 104929556 missense probably damaging 1.00
R7952:Ccdc73 UTSW 2 104945456 critical splice donor site probably null
R8178:Ccdc73 UTSW 2 104991212 missense probably benign 0.00
R8824:Ccdc73 UTSW 2 104991877 missense possibly damaging 0.74
R8927:Ccdc73 UTSW 2 104992197 missense
R8928:Ccdc73 UTSW 2 104992197 missense
R8945:Ccdc73 UTSW 2 104991367 missense probably benign 0.03
R9365:Ccdc73 UTSW 2 104907666 missense probably damaging 1.00
Z1177:Ccdc73 UTSW 2 104992239 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGGCAGAGCCAAGAATTTAGCATC -3'
(R):5'- TGGGTTGCTTTCAGAACCATCTGTG -3'

Sequencing Primer
(F):5'- TTTAGCATCCAGACATACACTTGC -3'
(R):5'- TTGACATGCCATTAGAGGATGC -3'
Posted On 2013-10-16