Incidental Mutation 'R0839:Tmem33'
ID78095
Institutional Source Beutler Lab
Gene Symbol Tmem33
Ensembl Gene ENSMUSG00000037720
Gene Nametransmembrane protein 33
Synonyms2700052H22Rik, 5430406L04Rik, 1110006G02Rik, 1600019D15Rik, 2410089A21Rik
MMRRC Submission 039018-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R0839 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location67260565-67291461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67264308 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 60 (L60Q)
Ref Sequence ENSEMBL: ENSMUSP00000124765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037918] [ENSMUST00000160352] [ENSMUST00000161233] [ENSMUST00000161369] [ENSMUST00000162074] [ENSMUST00000162543] [ENSMUST00000201979]
Predicted Effect probably damaging
Transcript: ENSMUST00000037918
AA Change: L60Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042852
Gene: ENSMUSG00000037720
AA Change: L60Q

DomainStartEndE-ValueType
Pfam:UPF0121 1 247 9.8e-126 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160352
AA Change: L60Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124766
Gene: ENSMUSG00000037720
AA Change: L60Q

DomainStartEndE-ValueType
Pfam:UPF0121 1 246 2.8e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161233
Predicted Effect probably damaging
Transcript: ENSMUST00000161369
AA Change: L60Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124390
Gene: ENSMUSG00000037720
AA Change: L60Q

DomainStartEndE-ValueType
Pfam:UPF0121 7 245 1.8e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162074
Predicted Effect probably damaging
Transcript: ENSMUST00000162543
AA Change: L60Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124765
Gene: ENSMUSG00000037720
AA Change: L60Q

DomainStartEndE-ValueType
Pfam:UPF0121 1 119 2.1e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201816
Predicted Effect probably benign
Transcript: ENSMUST00000201979
SMART Domains Protein: ENSMUSP00000144531
Gene: ENSMUSG00000037720

DomainStartEndE-ValueType
Pfam:UPF0121 7 61 5.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202324
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,126,878 V1083M probably damaging Het
Aco2 A G 15: 81,907,535 probably null Het
AI661453 A T 17: 47,436,827 Q8L probably null Het
Ankrd42 T C 7: 92,612,772 D295G possibly damaging Het
Ccdc73 A T 2: 104,991,097 I464L probably benign Het
Cdc5l A C 17: 45,393,147 M717R probably benign Het
Col4a1 G A 8: 11,221,015 P809S probably damaging Het
Dctn1 T C 6: 83,190,477 M358T possibly damaging Het
Dgkz A G 2: 91,935,111 S799P probably benign Het
Dna2 T C 10: 62,969,782 C933R probably damaging Het
Dock6 T C 9: 21,817,892 N1275S probably benign Het
Ect2l A G 10: 18,141,904 I659T probably benign Het
Ets1 T A 9: 32,734,061 Y201* probably null Het
Gle1 T A 2: 29,958,450 C679S probably benign Het
Gm10118 T G 10: 63,926,864 probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
H2-Q7 A G 17: 35,439,712 S109G probably damaging Het
Igfn1 A G 1: 135,954,680 V2809A probably damaging Het
Izumo1 T A 7: 45,627,112 D366E probably benign Het
Kctd20 A T 17: 28,957,898 M1L possibly damaging Het
Lct C T 1: 128,286,609 A1809T probably benign Het
Manea T C 4: 26,327,983 I353V probably damaging Het
Mybl2 T C 2: 163,075,768 Y65H probably benign Het
Myh11 C T 16: 14,203,178 E1744K probably damaging Het
Neb T C 2: 52,277,548 D1922G probably damaging Het
Nepro C A 16: 44,736,019 D513E probably benign Het
Nnt A T 13: 119,394,656 I185K possibly damaging Het
Npat A T 9: 53,545,180 Q17L probably damaging Het
Nup155 A G 15: 8,145,587 E956G possibly damaging Het
Olfr1375 A G 11: 51,048,427 I107V probably benign Het
Olfr1537 A T 9: 39,237,850 N191K possibly damaging Het
Olfr237-ps1 T A 6: 43,153,624 F106L probably benign Het
Olfr311 G A 11: 58,841,652 M179I probably benign Het
Olfr395 T A 11: 73,907,312 Y60F probably damaging Het
Olfr735 A G 14: 50,346,088 V118A probably damaging Het
Olfr967 A T 9: 39,750,391 I2L probably benign Het
Pah T C 10: 87,522,062 S16P probably damaging Het
Pcdh15 C A 10: 74,626,782 P1365Q probably null Het
Pds5b G T 5: 150,764,962 V640F probably benign Het
Pgam5 A T 5: 110,267,130 H72Q probably benign Het
Plagl2 C A 2: 153,232,541 A147S probably damaging Het
Ppfia4 A T 1: 134,328,807 L113Q probably null Het
Ppp1r12a T C 10: 108,198,861 V89A probably damaging Het
Ptprc A G 1: 138,101,132 Y443H possibly damaging Het
Ralgapb T C 2: 158,473,283 probably null Het
Rgsl1 A G 1: 153,802,234 probably null Het
Rubcn A C 16: 32,827,343 I681M probably damaging Het
Scaf11 A G 15: 96,423,553 L169S probably damaging Het
Scgb1b27 A G 7: 34,021,851 K55E probably benign Het
Sos1 A T 17: 80,433,730 I542N probably damaging Het
Syf2 T A 4: 134,936,063 V182D probably damaging Het
Tapbp T C 17: 33,925,743 V271A probably benign Het
Tmf1 A G 6: 97,176,323 V263A probably damaging Het
Vps13c T C 9: 67,898,738 V798A probably benign Het
Zfp384 C A 6: 125,036,668 D550E probably benign Het
Other mutations in Tmem33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Tmem33 APN 5 67284195 missense probably damaging 1.00
IGL02076:Tmem33 APN 5 67286103 missense probably damaging 1.00
IGL03106:Tmem33 APN 5 67263796 missense probably damaging 1.00
commonplace UTSW 5 67264459 critical splice donor site probably null
R0573:Tmem33 UTSW 5 67264260 intron probably benign
R1129:Tmem33 UTSW 5 67264460 splice site probably null
R1438:Tmem33 UTSW 5 67267291 splice site probably null
R1692:Tmem33 UTSW 5 67268554 missense probably null 0.57
R4513:Tmem33 UTSW 5 67286125 missense probably benign 0.02
R4763:Tmem33 UTSW 5 67286136 missense probably benign 0.22
R6298:Tmem33 UTSW 5 67268551 nonsense probably null
R6673:Tmem33 UTSW 5 67286125 missense probably benign 0.02
R6813:Tmem33 UTSW 5 67264459 critical splice donor site probably null
R7186:Tmem33 UTSW 5 67263787 missense possibly damaging 0.68
R7378:Tmem33 UTSW 5 67286133 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACTGCTCGTTGAAAAGCTGAGG -3'
(R):5'- CTCCACTGTCCCAGCAATGAAAGG -3'

Sequencing Primer
(F):5'- CCCAGAGTGTGGAGTACATTTG -3'
(R):5'- TCCCAGCAATGAAAGGATACTTG -3'
Posted On2013-10-16