Incidental Mutation 'R0839:Dctn1'
ID78100
Institutional Source Beutler Lab
Gene Symbol Dctn1
Ensembl Gene ENSMUSG00000031865
Gene Namedynactin 1
Synonymsp150, Glued, p150
MMRRC Submission 039018-MU
Accession Numbers

Ncbi RefSeq: NM_007835.2, NM_001198866.1, NM_001198867.1; MGI: 107745

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0839 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83165920-83200117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83190477 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 358 (M358T)
Ref Sequence ENSEMBL: ENSMUSP00000076623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077407] [ENSMUST00000113907] [ENSMUST00000113913] [ENSMUST00000113918] [ENSMUST00000113919] [ENSMUST00000130212] [ENSMUST00000141680]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077407
AA Change: M358T

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076623
Gene: ENSMUSG00000031865
AA Change: M358T

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
SCOP:d1fxkc_ 185 337 3e-3 SMART
low complexity region 363 379 N/A INTRINSIC
Pfam:Dynactin 489 768 8.2e-91 PFAM
low complexity region 800 820 N/A INTRINSIC
coiled coil region 914 1009 N/A INTRINSIC
low complexity region 1025 1043 N/A INTRINSIC
coiled coil region 1143 1172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113907
AA Change: M261T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000109540
Gene: ENSMUSG00000031865
AA Change: M261T

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
low complexity region 27 50 N/A INTRINSIC
low complexity region 51 80 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
SCOP:d1lxa__ 271 345 8e-3 SMART
Pfam:Dynactin 392 671 7.1e-91 PFAM
low complexity region 703 723 N/A INTRINSIC
coiled coil region 817 912 N/A INTRINSIC
low complexity region 928 946 N/A INTRINSIC
coiled coil region 1046 1075 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113913
AA Change: M378T
SMART Domains Protein: ENSMUSP00000109546
Gene: ENSMUSG00000031865
AA Change: M378T

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 118 139 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 168 197 N/A INTRINSIC
SCOP:d1fxkc_ 205 357 3e-3 SMART
low complexity region 383 399 N/A INTRINSIC
Pfam:Dynactin 509 788 2.5e-90 PFAM
low complexity region 820 840 N/A INTRINSIC
coiled coil region 934 1029 N/A INTRINSIC
low complexity region 1051 1069 N/A INTRINSIC
coiled coil region 1168 1197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113918
AA Change: M395T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000109551
Gene: ENSMUSG00000031865
AA Change: M395T

DomainStartEndE-ValueType
CAP_GLY 29 95 5.52e-31 SMART
low complexity region 135 156 N/A INTRINSIC
low complexity region 161 184 N/A INTRINSIC
low complexity region 185 214 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 400 416 N/A INTRINSIC
Pfam:Dynactin 526 805 3.3e-90 PFAM
low complexity region 837 857 N/A INTRINSIC
coiled coil region 951 1046 N/A INTRINSIC
coiled coil region 1147 1176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113919
AA Change: M395T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000109552
Gene: ENSMUSG00000031865
AA Change: M395T

DomainStartEndE-ValueType
CAP_GLY 29 95 5.52e-31 SMART
low complexity region 135 156 N/A INTRINSIC
low complexity region 161 184 N/A INTRINSIC
low complexity region 185 214 N/A INTRINSIC
SCOP:d1fxkc_ 222 374 3e-3 SMART
low complexity region 400 416 N/A INTRINSIC
Pfam:Dynactin 522 805 1.4e-103 PFAM
low complexity region 837 857 N/A INTRINSIC
coiled coil region 951 1046 N/A INTRINSIC
low complexity region 1068 1086 N/A INTRINSIC
coiled coil region 1185 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127824
Predicted Effect probably benign
Transcript: ENSMUST00000130212
SMART Domains Protein: ENSMUSP00000115838
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130917
Predicted Effect probably benign
Transcript: ENSMUST00000141680
SMART Domains Protein: ENSMUSP00000121538
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 118 139 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154420
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype Strain: 3769512
Lethality: E8-E10
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. Dynactin is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit interacts with dynein intermediate chain by its domains directly binding to dynein and binds to microtubules via a highly conserved glycine-rich cytoskeleton-associated protein (CAP-Gly) domain in its N-terminus. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause distal hereditary motor neuronopathy type VIIB (HMN7B) which is also known as distal spinal and bulbar muscular atrophy (dSBMA). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality and developmental arrest at E7.5 associated with increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted(4) Gene trapped(16)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,126,878 V1083M probably damaging Het
Aco2 A G 15: 81,907,535 probably null Het
AI661453 A T 17: 47,436,827 Q8L probably null Het
Ankrd42 T C 7: 92,612,772 D295G possibly damaging Het
Ccdc73 A T 2: 104,991,097 I464L probably benign Het
Cdc5l A C 17: 45,393,147 M717R probably benign Het
Col4a1 G A 8: 11,221,015 P809S probably damaging Het
Dgkz A G 2: 91,935,111 S799P probably benign Het
Dna2 T C 10: 62,969,782 C933R probably damaging Het
Dock6 T C 9: 21,817,892 N1275S probably benign Het
Ect2l A G 10: 18,141,904 I659T probably benign Het
Ets1 T A 9: 32,734,061 Y201* probably null Het
Gle1 T A 2: 29,958,450 C679S probably benign Het
Gm10118 T G 10: 63,926,864 probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
H2-Q7 A G 17: 35,439,712 S109G probably damaging Het
Igfn1 A G 1: 135,954,680 V2809A probably damaging Het
Izumo1 T A 7: 45,627,112 D366E probably benign Het
Kctd20 A T 17: 28,957,898 M1L possibly damaging Het
Lct C T 1: 128,286,609 A1809T probably benign Het
Manea T C 4: 26,327,983 I353V probably damaging Het
Mybl2 T C 2: 163,075,768 Y65H probably benign Het
Myh11 C T 16: 14,203,178 E1744K probably damaging Het
Neb T C 2: 52,277,548 D1922G probably damaging Het
Nepro C A 16: 44,736,019 D513E probably benign Het
Nnt A T 13: 119,394,656 I185K possibly damaging Het
Npat A T 9: 53,545,180 Q17L probably damaging Het
Nup155 A G 15: 8,145,587 E956G possibly damaging Het
Olfr1375 A G 11: 51,048,427 I107V probably benign Het
Olfr1537 A T 9: 39,237,850 N191K possibly damaging Het
Olfr237-ps1 T A 6: 43,153,624 F106L probably benign Het
Olfr311 G A 11: 58,841,652 M179I probably benign Het
Olfr395 T A 11: 73,907,312 Y60F probably damaging Het
Olfr735 A G 14: 50,346,088 V118A probably damaging Het
Olfr967 A T 9: 39,750,391 I2L probably benign Het
Pah T C 10: 87,522,062 S16P probably damaging Het
Pcdh15 C A 10: 74,626,782 P1365Q probably null Het
Pds5b G T 5: 150,764,962 V640F probably benign Het
Pgam5 A T 5: 110,267,130 H72Q probably benign Het
Plagl2 C A 2: 153,232,541 A147S probably damaging Het
Ppfia4 A T 1: 134,328,807 L113Q probably null Het
Ppp1r12a T C 10: 108,198,861 V89A probably damaging Het
Ptprc A G 1: 138,101,132 Y443H possibly damaging Het
Ralgapb T C 2: 158,473,283 probably null Het
Rgsl1 A G 1: 153,802,234 probably null Het
Rubcn A C 16: 32,827,343 I681M probably damaging Het
Scaf11 A G 15: 96,423,553 L169S probably damaging Het
Scgb1b27 A G 7: 34,021,851 K55E probably benign Het
Sos1 A T 17: 80,433,730 I542N probably damaging Het
Syf2 T A 4: 134,936,063 V182D probably damaging Het
Tapbp T C 17: 33,925,743 V271A probably benign Het
Tmem33 T A 5: 67,264,308 L60Q probably damaging Het
Tmf1 A G 6: 97,176,323 V263A probably damaging Het
Vps13c T C 9: 67,898,738 V798A probably benign Het
Zfp384 C A 6: 125,036,668 D550E probably benign Het
Other mutations in Dctn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Dctn1 APN 6 83179897 missense probably benign 0.00
IGL01450:Dctn1 APN 6 83194110 unclassified probably benign
IGL01876:Dctn1 APN 6 83197921 missense probably damaging 1.00
IGL01958:Dctn1 APN 6 83191344 missense possibly damaging 0.95
IGL02554:Dctn1 APN 6 83182722 missense probably damaging 1.00
IGL02668:Dctn1 APN 6 83191048 missense possibly damaging 0.89
IGL02814:Dctn1 APN 6 83189914 missense probably damaging 1.00
IGL02818:Dctn1 APN 6 83192514 missense possibly damaging 0.86
IGL03007:Dctn1 APN 6 83182708 missense probably damaging 1.00
IGL03065:Dctn1 APN 6 83192493 missense probably damaging 0.99
IGL03083:Dctn1 APN 6 83197484 splice site probably benign
IGL03394:Dctn1 APN 6 83191284 missense possibly damaging 0.61
E0374:Dctn1 UTSW 6 83194174 missense possibly damaging 0.93
IGL03014:Dctn1 UTSW 6 83197369 intron probably benign
PIT4812001:Dctn1 UTSW 6 83199762 missense possibly damaging 0.86
R0044:Dctn1 UTSW 6 83191134 missense probably damaging 1.00
R0047:Dctn1 UTSW 6 83182632 nonsense probably null
R0047:Dctn1 UTSW 6 83182632 nonsense probably null
R0057:Dctn1 UTSW 6 83179892 missense probably benign 0.14
R0731:Dctn1 UTSW 6 83183089 missense probably damaging 0.98
R0738:Dctn1 UTSW 6 83190107 critical splice donor site probably null
R0755:Dctn1 UTSW 6 83189077 missense probably damaging 0.96
R1035:Dctn1 UTSW 6 83190220 missense probably damaging 1.00
R1454:Dctn1 UTSW 6 83197508 missense possibly damaging 0.93
R1469:Dctn1 UTSW 6 83192889 missense probably damaging 1.00
R1469:Dctn1 UTSW 6 83192889 missense probably damaging 1.00
R1627:Dctn1 UTSW 6 83195082 missense probably damaging 0.99
R1631:Dctn1 UTSW 6 83197596 missense possibly damaging 0.56
R1812:Dctn1 UTSW 6 83192518 missense possibly damaging 0.85
R1928:Dctn1 UTSW 6 83199184 splice site probably benign
R2008:Dctn1 UTSW 6 83189956 missense probably damaging 0.99
R2242:Dctn1 UTSW 6 83199705 missense probably damaging 0.99
R2259:Dctn1 UTSW 6 83197586 missense possibly damaging 0.46
R2422:Dctn1 UTSW 6 83199800 missense possibly damaging 0.92
R2483:Dctn1 UTSW 6 83194187 missense probably damaging 1.00
R4455:Dctn1 UTSW 6 83195049 missense probably damaging 1.00
R4724:Dctn1 UTSW 6 83189938 missense possibly damaging 0.53
R4812:Dctn1 UTSW 6 83189937 missense probably benign 0.24
R4819:Dctn1 UTSW 6 83190519 missense probably damaging 0.97
R4831:Dctn1 UTSW 6 83199771 missense possibly damaging 0.46
R4928:Dctn1 UTSW 6 83189207 missense possibly damaging 0.73
R5087:Dctn1 UTSW 6 83191639 missense probably damaging 1.00
R5354:Dctn1 UTSW 6 83183126 missense possibly damaging 0.93
R5372:Dctn1 UTSW 6 83190210 missense probably damaging 0.96
R5493:Dctn1 UTSW 6 83182564 missense possibly damaging 0.89
R5494:Dctn1 UTSW 6 83182564 missense possibly damaging 0.89
R5732:Dctn1 UTSW 6 83197949 critical splice donor site probably null
R5856:Dctn1 UTSW 6 83197865 missense probably damaging 1.00
R6025:Dctn1 UTSW 6 83193691 intron probably null
R6999:Dctn1 UTSW 6 83191281 missense possibly damaging 0.89
R7052:Dctn1 UTSW 6 83195280 intron probably null
R7133:Dctn1 UTSW 6 83180044 intron probably null
R7485:Dctn1 UTSW 6 83189905 missense possibly damaging 0.85
R7607:Dctn1 UTSW 6 83195069 nonsense probably null
R7729:Dctn1 UTSW 6 83183060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTACCTTGTGACAGACCGACC -3'
(R):5'- TTCATGGCTTCCTGGATGGCAC -3'

Sequencing Primer
(F):5'- GACCGACACATGCTTTCTG -3'
(R):5'- TCTCCATCAGGGTGAGAAGTC -3'
Posted On2013-10-16