Incidental Mutation 'R0839:Nnt'
ID78127
Institutional Source Beutler Lab
Gene Symbol Nnt
Ensembl Gene ENSMUSG00000025453
Gene Namenicotinamide nucleotide transhydrogenase
Synonyms
MMRRC Submission 039018-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R0839 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location119335448-119408997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119394656 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 185 (I185K)
Ref Sequence ENSEMBL: ENSMUSP00000070564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069902] [ENSMUST00000099149] [ENSMUST00000109204] [ENSMUST00000223268]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069902
AA Change: I185K

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070564
Gene: ENSMUSG00000025453
AA Change: I185K

DomainStartEndE-ValueType
AlaDh_PNT_N 60 199 3.35e-62 SMART
AlaDh_PNT_C 208 377 5.76e-43 SMART
transmembrane domain 409 431 N/A INTRINSIC
transmembrane domain 451 473 N/A INTRINSIC
transmembrane domain 486 508 N/A INTRINSIC
PDB:1U31|B 515 721 1e-145 PDB
SCOP:d1d4oa_ 542 718 1e-103 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099149
AA Change: I185K

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096753
Gene: ENSMUSG00000025453
AA Change: I185K

DomainStartEndE-ValueType
AlaDh_PNT_N 60 199 3.35e-62 SMART
AlaDh_PNT_C 208 375 1.27e-39 SMART
transmembrane domain 395 412 N/A INTRINSIC
Blast:AlaDh_PNT_C 436 491 3e-28 BLAST
transmembrane domain 523 545 N/A INTRINSIC
transmembrane domain 565 587 N/A INTRINSIC
transmembrane domain 600 622 N/A INTRINSIC
PDB:1U31|B 629 835 1e-143 PDB
SCOP:d1d4oa_ 656 832 1e-102 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109204
AA Change: I185K

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104827
Gene: ENSMUSG00000025453
AA Change: I185K

DomainStartEndE-ValueType
AlaDh_PNT_N 60 199 3.35e-62 SMART
AlaDh_PNT_C 208 375 1.27e-39 SMART
transmembrane domain 395 412 N/A INTRINSIC
Blast:AlaDh_PNT_C 436 491 2e-28 BLAST
transmembrane domain 523 545 N/A INTRINSIC
transmembrane domain 565 587 N/A INTRINSIC
transmembrane domain 600 622 N/A INTRINSIC
PDB:1U31|B 629 709 9e-46 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144599
Predicted Effect possibly damaging
Transcript: ENSMUST00000223268
AA Change: I185K

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations in this gene cause impaired glucose tolerance and loss of both glucose-dependent insulin secretion and ATP production in isolated pancreatic islets. Also, beta cells from ENU-induced mutants show enhanced glucose utilization and production of reactive oxygen species in response to glucose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,126,878 V1083M probably damaging Het
Aco2 A G 15: 81,907,535 probably null Het
AI661453 A T 17: 47,436,827 Q8L probably null Het
Ankrd42 T C 7: 92,612,772 D295G possibly damaging Het
Ccdc73 A T 2: 104,991,097 I464L probably benign Het
Cdc5l A C 17: 45,393,147 M717R probably benign Het
Col4a1 G A 8: 11,221,015 P809S probably damaging Het
Dctn1 T C 6: 83,190,477 M358T possibly damaging Het
Dgkz A G 2: 91,935,111 S799P probably benign Het
Dna2 T C 10: 62,969,782 C933R probably damaging Het
Dock6 T C 9: 21,817,892 N1275S probably benign Het
Ect2l A G 10: 18,141,904 I659T probably benign Het
Ets1 T A 9: 32,734,061 Y201* probably null Het
Gle1 T A 2: 29,958,450 C679S probably benign Het
Gm10118 T G 10: 63,926,864 probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
H2-Q7 A G 17: 35,439,712 S109G probably damaging Het
Igfn1 A G 1: 135,954,680 V2809A probably damaging Het
Izumo1 T A 7: 45,627,112 D366E probably benign Het
Kctd20 A T 17: 28,957,898 M1L possibly damaging Het
Lct C T 1: 128,286,609 A1809T probably benign Het
Manea T C 4: 26,327,983 I353V probably damaging Het
Mybl2 T C 2: 163,075,768 Y65H probably benign Het
Myh11 C T 16: 14,203,178 E1744K probably damaging Het
Neb T C 2: 52,277,548 D1922G probably damaging Het
Nepro C A 16: 44,736,019 D513E probably benign Het
Npat A T 9: 53,545,180 Q17L probably damaging Het
Nup155 A G 15: 8,145,587 E956G possibly damaging Het
Olfr1375 A G 11: 51,048,427 I107V probably benign Het
Olfr1537 A T 9: 39,237,850 N191K possibly damaging Het
Olfr237-ps1 T A 6: 43,153,624 F106L probably benign Het
Olfr311 G A 11: 58,841,652 M179I probably benign Het
Olfr395 T A 11: 73,907,312 Y60F probably damaging Het
Olfr735 A G 14: 50,346,088 V118A probably damaging Het
Olfr967 A T 9: 39,750,391 I2L probably benign Het
Pah T C 10: 87,522,062 S16P probably damaging Het
Pcdh15 C A 10: 74,626,782 P1365Q probably null Het
Pds5b G T 5: 150,764,962 V640F probably benign Het
Pgam5 A T 5: 110,267,130 H72Q probably benign Het
Plagl2 C A 2: 153,232,541 A147S probably damaging Het
Ppfia4 A T 1: 134,328,807 L113Q probably null Het
Ppp1r12a T C 10: 108,198,861 V89A probably damaging Het
Ptprc A G 1: 138,101,132 Y443H possibly damaging Het
Ralgapb T C 2: 158,473,283 probably null Het
Rgsl1 A G 1: 153,802,234 probably null Het
Rubcn A C 16: 32,827,343 I681M probably damaging Het
Scaf11 A G 15: 96,423,553 L169S probably damaging Het
Scgb1b27 A G 7: 34,021,851 K55E probably benign Het
Sos1 A T 17: 80,433,730 I542N probably damaging Het
Syf2 T A 4: 134,936,063 V182D probably damaging Het
Tapbp T C 17: 33,925,743 V271A probably benign Het
Tmem33 T A 5: 67,264,308 L60Q probably damaging Het
Tmf1 A G 6: 97,176,323 V263A probably damaging Het
Vps13c T C 9: 67,898,738 V798A probably benign Het
Zfp384 C A 6: 125,036,668 D550E probably benign Het
Other mutations in Nnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nnt APN 13 119369997 missense probably damaging 1.00
IGL02021:Nnt APN 13 119336247 utr 3 prime probably benign
IGL02792:Nnt APN 13 119357646 missense probably damaging 1.00
IGL02804:Nnt APN 13 119381674 critical splice donor site probably null
IGL03082:Nnt APN 13 119396868 missense probably damaging 1.00
BB001:Nnt UTSW 13 119386645 missense probably damaging 1.00
BB011:Nnt UTSW 13 119386645 missense probably damaging 1.00
R0122:Nnt UTSW 13 119368597 missense probably damaging 1.00
R0294:Nnt UTSW 13 119336267 missense probably benign 0.08
R0294:Nnt UTSW 13 119338417 missense possibly damaging 0.79
R0530:Nnt UTSW 13 119394721 missense probably damaging 1.00
R1590:Nnt UTSW 13 119386661 missense possibly damaging 0.90
R1642:Nnt UTSW 13 119404550 critical splice donor site probably null
R3772:Nnt UTSW 13 119396952 missense probably damaging 0.99
R3835:Nnt UTSW 13 119372495 missense probably damaging 1.00
R3921:Nnt UTSW 13 119366494 missense probably damaging 1.00
R4106:Nnt UTSW 13 119396791 missense probably benign 0.15
R4496:Nnt UTSW 13 119381765 missense probably damaging 1.00
R4609:Nnt UTSW 13 119357536 missense possibly damaging 0.80
R4897:Nnt UTSW 13 119404571 nonsense probably null
R5081:Nnt UTSW 13 119366400 missense probably damaging 0.98
R5461:Nnt UTSW 13 119368595 missense possibly damaging 0.96
R5842:Nnt UTSW 13 119394747 missense probably damaging 0.97
R6053:Nnt UTSW 13 119357509 missense possibly damaging 0.90
R6137:Nnt UTSW 13 119336328 missense possibly damaging 0.95
R7134:Nnt UTSW 13 119394662 missense probably damaging 0.98
R7815:Nnt UTSW 13 119357575 missense possibly damaging 0.80
R7831:Nnt UTSW 13 119370094 missense possibly damaging 0.57
R7924:Nnt UTSW 13 119386645 missense probably damaging 1.00
R8046:Nnt UTSW 13 119374750 missense probably damaging 1.00
R8152:Nnt UTSW 13 119374676 missense probably benign 0.23
R8356:Nnt UTSW 13 119339832 missense probably damaging 1.00
R8461:Nnt UTSW 13 119368502 missense unknown
R8839:Nnt UTSW 13 119357637 missense unknown
R8860:Nnt UTSW 13 119339871 missense
RF007:Nnt UTSW 13 119396857 missense probably damaging 1.00
Z1088:Nnt UTSW 13 119338446 missense probably damaging 1.00
Z1177:Nnt UTSW 13 119354741 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTCTTACGCAGACCCTCAGACAGC -3'
(R):5'- TGGGGAGACCAGGTTCACTGTAAAG -3'

Sequencing Primer
(F):5'- CTCAGACAGCTACTTTCTTTGATAGG -3'
(R):5'- TGTAGCTGTCACAGATGACC -3'
Posted On2013-10-16