Incidental Mutation 'R0839:Olfr735'
ID78128
Institutional Source Beutler Lab
Gene Symbol Olfr735
Ensembl Gene ENSMUSG00000046210
Gene Nameolfactory receptor 735
SynonymsMOR243-1, GA_x6K02T2PMLR-6042130-6041183
MMRRC Submission 039018-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R0839 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50342612-50348872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50346088 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 118 (V118A)
Ref Sequence ENSEMBL: ENSMUSP00000056851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049729] [ENSMUST00000216634]
Predicted Effect probably damaging
Transcript: ENSMUST00000049729
AA Change: V118A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056851
Gene: ENSMUSG00000046210
AA Change: V118A

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
Pfam:7tm_4 70 345 1.6e-49 PFAM
Pfam:7tm_1 80 345 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206546
Predicted Effect probably damaging
Transcript: ENSMUST00000216634
AA Change: V87A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,126,878 V1083M probably damaging Het
Aco2 A G 15: 81,907,535 probably null Het
AI661453 A T 17: 47,436,827 Q8L probably null Het
Ankrd42 T C 7: 92,612,772 D295G possibly damaging Het
Ccdc73 A T 2: 104,991,097 I464L probably benign Het
Cdc5l A C 17: 45,393,147 M717R probably benign Het
Col4a1 G A 8: 11,221,015 P809S probably damaging Het
Dctn1 T C 6: 83,190,477 M358T possibly damaging Het
Dgkz A G 2: 91,935,111 S799P probably benign Het
Dna2 T C 10: 62,969,782 C933R probably damaging Het
Dock6 T C 9: 21,817,892 N1275S probably benign Het
Ect2l A G 10: 18,141,904 I659T probably benign Het
Ets1 T A 9: 32,734,061 Y201* probably null Het
Gle1 T A 2: 29,958,450 C679S probably benign Het
Gm10118 T G 10: 63,926,864 probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
H2-Q7 A G 17: 35,439,712 S109G probably damaging Het
Igfn1 A G 1: 135,954,680 V2809A probably damaging Het
Izumo1 T A 7: 45,627,112 D366E probably benign Het
Kctd20 A T 17: 28,957,898 M1L possibly damaging Het
Lct C T 1: 128,286,609 A1809T probably benign Het
Manea T C 4: 26,327,983 I353V probably damaging Het
Mybl2 T C 2: 163,075,768 Y65H probably benign Het
Myh11 C T 16: 14,203,178 E1744K probably damaging Het
Neb T C 2: 52,277,548 D1922G probably damaging Het
Nepro C A 16: 44,736,019 D513E probably benign Het
Nnt A T 13: 119,394,656 I185K possibly damaging Het
Npat A T 9: 53,545,180 Q17L probably damaging Het
Nup155 A G 15: 8,145,587 E956G possibly damaging Het
Olfr1375 A G 11: 51,048,427 I107V probably benign Het
Olfr1537 A T 9: 39,237,850 N191K possibly damaging Het
Olfr237-ps1 T A 6: 43,153,624 F106L probably benign Het
Olfr311 G A 11: 58,841,652 M179I probably benign Het
Olfr395 T A 11: 73,907,312 Y60F probably damaging Het
Olfr967 A T 9: 39,750,391 I2L probably benign Het
Pah T C 10: 87,522,062 S16P probably damaging Het
Pcdh15 C A 10: 74,626,782 P1365Q probably null Het
Pds5b G T 5: 150,764,962 V640F probably benign Het
Pgam5 A T 5: 110,267,130 H72Q probably benign Het
Plagl2 C A 2: 153,232,541 A147S probably damaging Het
Ppfia4 A T 1: 134,328,807 L113Q probably null Het
Ppp1r12a T C 10: 108,198,861 V89A probably damaging Het
Ptprc A G 1: 138,101,132 Y443H possibly damaging Het
Ralgapb T C 2: 158,473,283 probably null Het
Rgsl1 A G 1: 153,802,234 probably null Het
Rubcn A C 16: 32,827,343 I681M probably damaging Het
Scaf11 A G 15: 96,423,553 L169S probably damaging Het
Scgb1b27 A G 7: 34,021,851 K55E probably benign Het
Sos1 A T 17: 80,433,730 I542N probably damaging Het
Syf2 T A 4: 134,936,063 V182D probably damaging Het
Tapbp T C 17: 33,925,743 V271A probably benign Het
Tmem33 T A 5: 67,264,308 L60Q probably damaging Het
Tmf1 A G 6: 97,176,323 V263A probably damaging Het
Vps13c T C 9: 67,898,738 V798A probably benign Het
Zfp384 C A 6: 125,036,668 D550E probably benign Het
Other mutations in Olfr735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr735 APN 14 50345614 missense probably damaging 0.99
IGL01655:Olfr735 APN 14 50346184 missense probably benign 0.01
IGL02838:Olfr735 APN 14 50345855 missense probably damaging 1.00
IGL02874:Olfr735 APN 14 50346126 missense probably damaging 1.00
R0609:Olfr735 UTSW 14 50345926 missense probably damaging 1.00
R0724:Olfr735 UTSW 14 50345917 missense possibly damaging 0.89
R1766:Olfr735 UTSW 14 50346220 missense probably damaging 1.00
R1799:Olfr735 UTSW 14 50346080 missense probably benign 0.32
R4934:Olfr735 UTSW 14 50345888 missense probably damaging 1.00
R5753:Olfr735 UTSW 14 50345588 missense probably damaging 0.96
R5996:Olfr735 UTSW 14 50345512 missense possibly damaging 0.89
R6555:Olfr735 UTSW 14 50345846 nonsense probably null
R6736:Olfr735 UTSW 14 50345448 missense probably damaging 1.00
R7841:Olfr735 UTSW 14 50345828 missense probably benign 0.09
R7922:Olfr735 UTSW 14 50346415 missense probably benign 0.03
R8190:Olfr735 UTSW 14 50345722 missense probably damaging 0.99
R8308:Olfr735 UTSW 14 50345465 missense probably benign 0.06
R8560:Olfr735 UTSW 14 50346337 missense probably benign 0.12
X0019:Olfr735 UTSW 14 50345806 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATGACCGTCAGGTAGTGCAAAG -3'
(R):5'- TGCATGGTACACGCAGACAAGC -3'

Sequencing Primer
(F):5'- GGGTTGCATATGGCAACATACC -3'
(R):5'- GATACTCTTGGCTTGGAGAAAAAC -3'
Posted On2013-10-16