Incidental Mutation 'R0825:Aox4'
ID78161
Institutional Source Beutler Lab
Gene Symbol Aox4
Ensembl Gene ENSMUSG00000038242
Gene Namealdehyde oxidase 4
Synonyms2310003G12Rik, AOH2
MMRRC Submission 039005-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0825 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58210397-58268597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58248909 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 727 (D727G)
Ref Sequence ENSEMBL: ENSMUSP00000048929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040442]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040442
AA Change: D727G

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048929
Gene: ENSMUSG00000038242
AA Change: D727G

DomainStartEndE-ValueType
Pfam:Fer2 12 82 1.6e-10 PFAM
Pfam:Fer2_2 91 165 4.6e-30 PFAM
Pfam:FAD_binding_5 240 421 2.7e-47 PFAM
CO_deh_flav_C 428 532 1.19e-26 SMART
Ald_Xan_dh_C 596 699 8.22e-39 SMART
Pfam:Ald_Xan_dh_C2 709 1243 1.1e-178 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161926
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit a slight decrease in prenatal survival and epidermal thickening that is exacerbated by UV treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,400,577 I963N probably damaging Het
AF529169 G A 9: 89,603,279 Q22* probably null Het
Arhgef26 T A 3: 62,426,593 I590N probably damaging Het
Arid1b T G 17: 5,342,178 C1994W probably damaging Het
Chd9 T C 8: 91,051,197 I2628T probably benign Het
Clspn G A 4: 126,573,130 probably benign Het
Cyp2a4 A T 7: 26,312,916 T375S probably benign Het
Dmtf1 A T 5: 9,130,388 M226K probably damaging Het
Erap1 T C 13: 74,674,614 probably benign Het
Frmpd1 A G 4: 45,285,394 D1405G possibly damaging Het
Gfm2 A T 13: 97,143,104 probably benign Het
Ghsr T C 3: 27,374,627 V267A probably damaging Het
Golga2 A C 2: 32,304,791 Q650P probably damaging Het
Hmgcl A G 4: 135,960,070 T219A probably benign Het
Ift27 C A 15: 78,165,136 probably benign Het
Igfn1 C T 1: 135,963,126 E2379K probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kpnb1 A T 11: 97,171,675 S421R probably damaging Het
Mtx3 C A 13: 92,850,341 T264K probably damaging Het
Nrg3 G A 14: 39,472,391 P137L possibly damaging Het
Nt5c2 A G 19: 46,898,905 probably benign Het
Olfr1391 T A 11: 49,327,682 H90Q probably benign Het
Olfr199 G T 16: 59,216,450 H54Q possibly damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd5 G A 7: 35,646,913 R91W possibly damaging Het
Pxdn G A 12: 29,984,996 probably benign Het
Rgl2 T A 17: 33,935,159 probably null Het
Rnf217 T C 10: 31,517,457 D376G probably damaging Het
Sept9 C T 11: 117,359,460 L519F probably damaging Het
Slc15a5 C T 6: 138,018,089 C386Y possibly damaging Het
Srrm4 T A 5: 116,453,713 I256F unknown Het
Stab1 G T 14: 31,152,600 D950E probably benign Het
Stim2 A G 5: 54,118,483 T667A probably benign Het
Strbp A T 2: 37,635,527 N144K probably benign Het
Sync A G 4: 129,293,397 Y74C probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tgfbi T C 13: 56,638,710 probably benign Het
Tmf1 A T 6: 97,175,995 N372K probably benign Het
Ubr4 G T 4: 139,479,576 probably null Het
Uggt1 A T 1: 36,158,143 N1226K probably benign Het
Ugt2b34 T C 5: 86,906,701 I74V possibly damaging Het
Wdfy3 A G 5: 101,870,051 L2541P probably damaging Het
Zfhx3 T G 8: 108,949,208 F2297V probably damaging Het
Other mutations in Aox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Aox4 APN 1 58239174 missense probably damaging 1.00
IGL01011:Aox4 APN 1 58240775 nonsense probably null
IGL01634:Aox4 APN 1 58221930 missense possibly damaging 0.81
IGL01689:Aox4 APN 1 58245161 splice site probably benign
IGL01874:Aox4 APN 1 58252084 missense probably damaging 1.00
IGL02104:Aox4 APN 1 58236657 splice site probably benign
IGL02744:Aox4 APN 1 58255552 missense possibly damaging 0.90
IGL02751:Aox4 APN 1 58259052 missense probably damaging 1.00
IGL03225:Aox4 APN 1 58247227 missense possibly damaging 0.94
IGL03247:Aox4 APN 1 58264367 missense probably damaging 1.00
IGL03369:Aox4 APN 1 58262587 missense probably benign 0.01
BB008:Aox4 UTSW 1 58255486 missense probably benign 0.07
BB018:Aox4 UTSW 1 58255486 missense probably benign 0.07
R0138:Aox4 UTSW 1 58228866 missense probably damaging 1.00
R0243:Aox4 UTSW 1 58213076 missense probably benign
R0368:Aox4 UTSW 1 58213079 missense probably benign 0.07
R0499:Aox4 UTSW 1 58263397 critical splice donor site probably null
R0513:Aox4 UTSW 1 58217519 missense probably benign
R0513:Aox4 UTSW 1 58247300 missense probably damaging 1.00
R0546:Aox4 UTSW 1 58250174 missense probably damaging 1.00
R0591:Aox4 UTSW 1 58239102 splice site probably benign
R1912:Aox4 UTSW 1 58264402 missense probably damaging 1.00
R1934:Aox4 UTSW 1 58245936 missense probably benign 0.01
R2180:Aox4 UTSW 1 58213067 missense probably benign 0.00
R2293:Aox4 UTSW 1 58221937 missense probably damaging 0.99
R3017:Aox4 UTSW 1 58235204 missense probably benign
R3744:Aox4 UTSW 1 58245870 missense probably damaging 1.00
R3745:Aox4 UTSW 1 58245870 missense probably damaging 1.00
R3830:Aox4 UTSW 1 58255511 missense probably damaging 0.99
R3856:Aox4 UTSW 1 58253934 missense probably damaging 1.00
R4214:Aox4 UTSW 1 58221892 missense probably damaging 0.99
R4484:Aox4 UTSW 1 58262571 missense probably damaging 1.00
R4706:Aox4 UTSW 1 58266787 missense probably damaging 1.00
R4710:Aox4 UTSW 1 58255638 missense probably damaging 1.00
R4729:Aox4 UTSW 1 58259077 nonsense probably null
R4769:Aox4 UTSW 1 58259148 missense probably null 1.00
R4809:Aox4 UTSW 1 58266649 missense probably damaging 1.00
R4989:Aox4 UTSW 1 58236676 missense probably benign 0.00
R5082:Aox4 UTSW 1 58231483 missense possibly damaging 0.63
R5102:Aox4 UTSW 1 58240778 missense probably damaging 1.00
R5114:Aox4 UTSW 1 58246286 missense possibly damaging 0.89
R5133:Aox4 UTSW 1 58236676 missense probably benign 0.00
R5134:Aox4 UTSW 1 58236676 missense probably benign 0.00
R5185:Aox4 UTSW 1 58254318 missense probably damaging 1.00
R5217:Aox4 UTSW 1 58246241 nonsense probably null
R5426:Aox4 UTSW 1 58220094 missense probably damaging 1.00
R5443:Aox4 UTSW 1 58233992 splice site probably null
R5708:Aox4 UTSW 1 58245873 missense possibly damaging 0.69
R6052:Aox4 UTSW 1 58254318 nonsense probably null
R6167:Aox4 UTSW 1 58263935 missense probably damaging 1.00
R6179:Aox4 UTSW 1 58231503 missense probably benign
R6196:Aox4 UTSW 1 58217526 missense probably damaging 1.00
R6513:Aox4 UTSW 1 58213053 missense probably benign 0.01
R6781:Aox4 UTSW 1 58245109 missense probably benign 0.03
R6885:Aox4 UTSW 1 58264378 missense probably damaging 1.00
R7082:Aox4 UTSW 1 58224193 missense possibly damaging 0.82
R7127:Aox4 UTSW 1 58228874 missense probably benign 0.00
R7153:Aox4 UTSW 1 58250219 missense probably damaging 0.99
R7371:Aox4 UTSW 1 58263854 missense probably damaging 1.00
R7690:Aox4 UTSW 1 58263917 missense probably damaging 1.00
R7745:Aox4 UTSW 1 58240707 missense probably benign 0.01
R7752:Aox4 UTSW 1 58253948 missense not run
R7767:Aox4 UTSW 1 58235207 missense probably damaging 0.98
R7782:Aox4 UTSW 1 58231092 splice site probably null
R7931:Aox4 UTSW 1 58255486 missense probably benign 0.07
R7978:Aox4 UTSW 1 58235207 missense probably damaging 0.98
R7982:Aox4 UTSW 1 58257241 missense possibly damaging 0.81
R8316:Aox4 UTSW 1 58254311 missense possibly damaging 0.69
R8361:Aox4 UTSW 1 58240839 missense probably benign 0.03
R8829:Aox4 UTSW 1 58255490 missense probably benign 0.01
R8832:Aox4 UTSW 1 58255490 missense probably benign 0.01
R8896:Aox4 UTSW 1 58252074 missense probably benign
X0021:Aox4 UTSW 1 58247295 nonsense probably null
X0028:Aox4 UTSW 1 58254183 missense probably damaging 0.99
Z1176:Aox4 UTSW 1 58246351 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GCTCCAAGTGTCTGAGTGTGTAGC -3'
(R):5'- GCCATATGCCTGAGTCAGTGAATCC -3'

Sequencing Primer
(F):5'- TAGCTATCTGACAGCAAAGGG -3'
(R):5'- cacacacacacacacacac -3'
Posted On2013-10-16