Incidental Mutation 'R0825:Iqca'
Institutional Source Beutler Lab
Gene Symbol Iqca
Ensembl Gene ENSMUSG00000026301
Gene NameIQ motif containing with AAA domain
MMRRC Submission 039005-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0825 (G1)
Quality Score225
Status Validated
Chromosomal Location90042132-90153401 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 90142731 bp
Amino Acid Change Glycine to Valine at position 133 (G133V)
Ref Sequence ENSEMBL: ENSMUSP00000108717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113094] [ENSMUST00000113094] [ENSMUST00000212394] [ENSMUST00000212394]
Predicted Effect probably null
Transcript: ENSMUST00000113094
AA Change: G133V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108717
Gene: ENSMUSG00000026301
AA Change: G133V

IQ 205 227 6.97e0 SMART
coiled coil region 340 380 N/A INTRINSIC
coiled coil region 425 450 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
AAA 567 706 1.08e-3 SMART
low complexity region 812 829 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113094
AA Change: G133V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108717
Gene: ENSMUSG00000026301
AA Change: G133V

IQ 205 227 6.97e0 SMART
coiled coil region 340 380 N/A INTRINSIC
coiled coil region 425 450 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
AAA 567 706 1.08e-3 SMART
low complexity region 812 829 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211999
Predicted Effect probably null
Transcript: ENSMUST00000212394
AA Change: G133V

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably null
Transcript: ENSMUST00000212394
AA Change: G133V

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.1927 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ATPases Associated with diverse cellular Activities (AAA) superfamily. Members of this superfamily, found in all organisms, participate in a large number of cellular processes and contain the ATPase module consisting of an alpha-beta-alpha core domain and the Walker A and B motifs of the P-loop NTPases. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,400,577 I963N probably damaging Het
AF529169 G A 9: 89,603,279 Q22* probably null Het
Aox4 A G 1: 58,248,909 D727G possibly damaging Het
Arhgef26 T A 3: 62,426,593 I590N probably damaging Het
Arid1b T G 17: 5,342,178 C1994W probably damaging Het
Chd9 T C 8: 91,051,197 I2628T probably benign Het
Clspn G A 4: 126,573,130 probably benign Het
Cyp2a4 A T 7: 26,312,916 T375S probably benign Het
Dmtf1 A T 5: 9,130,388 M226K probably damaging Het
Erap1 T C 13: 74,674,614 probably benign Het
Frmpd1 A G 4: 45,285,394 D1405G possibly damaging Het
Gfm2 A T 13: 97,143,104 probably benign Het
Ghsr T C 3: 27,374,627 V267A probably damaging Het
Golga2 A C 2: 32,304,791 Q650P probably damaging Het
Hmgcl A G 4: 135,960,070 T219A probably benign Het
Ift27 C A 15: 78,165,136 probably benign Het
Igfn1 C T 1: 135,963,126 E2379K probably damaging Het
Kpnb1 A T 11: 97,171,675 S421R probably damaging Het
Mtx3 C A 13: 92,850,341 T264K probably damaging Het
Nrg3 G A 14: 39,472,391 P137L possibly damaging Het
Nt5c2 A G 19: 46,898,905 probably benign Het
Olfr1391 T A 11: 49,327,682 H90Q probably benign Het
Olfr199 G T 16: 59,216,450 H54Q possibly damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd5 G A 7: 35,646,913 R91W possibly damaging Het
Pxdn G A 12: 29,984,996 probably benign Het
Rgl2 T A 17: 33,935,159 probably null Het
Rnf217 T C 10: 31,517,457 D376G probably damaging Het
Sept9 C T 11: 117,359,460 L519F probably damaging Het
Slc15a5 C T 6: 138,018,089 C386Y possibly damaging Het
Srrm4 T A 5: 116,453,713 I256F unknown Het
Stab1 G T 14: 31,152,600 D950E probably benign Het
Stim2 A G 5: 54,118,483 T667A probably benign Het
Strbp A T 2: 37,635,527 N144K probably benign Het
Sync A G 4: 129,293,397 Y74C probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tgfbi T C 13: 56,638,710 probably benign Het
Tmf1 A T 6: 97,175,995 N372K probably benign Het
Ubr4 G T 4: 139,479,576 probably null Het
Uggt1 A T 1: 36,158,143 N1226K probably benign Het
Ugt2b34 T C 5: 86,906,701 I74V possibly damaging Het
Wdfy3 A G 5: 101,870,051 L2541P probably damaging Het
Zfhx3 T G 8: 108,949,208 F2297V probably damaging Het
Other mutations in Iqca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Iqca APN 1 90045657 missense probably benign 0.10
IGL01367:Iqca APN 1 90070628 splice site probably benign
IGL01545:Iqca APN 1 90045642 missense probably benign
IGL01797:Iqca APN 1 90144819 critical splice donor site probably null
IGL02098:Iqca APN 1 90047941 missense probably damaging 0.96
IGL02194:Iqca APN 1 90045663 missense probably benign 0.16
IGL03230:Iqca APN 1 90145002 missense probably damaging 1.00
IGL03259:Iqca APN 1 90052434 missense probably damaging 1.00
IGL03372:Iqca APN 1 90144969 missense possibly damaging 0.80
R0383:Iqca UTSW 1 90142707 missense probably damaging 1.00
R0610:Iqca UTSW 1 90142731 missense probably null 0.97
R0685:Iqca UTSW 1 90142731 missense probably null 0.97
R0798:Iqca UTSW 1 90142731 missense probably null 0.97
R0799:Iqca UTSW 1 90142731 missense probably null 0.97
R0800:Iqca UTSW 1 90142731 missense probably null 0.97
R0801:Iqca UTSW 1 90142731 missense probably null 0.97
R0826:Iqca UTSW 1 90142731 missense probably null 0.97
R0827:Iqca UTSW 1 90142731 missense probably null 0.97
R0862:Iqca UTSW 1 90142731 missense probably null 0.97
R0863:Iqca UTSW 1 90142731 missense probably null 0.97
R0864:Iqca UTSW 1 90142731 missense probably null 0.97
R0960:Iqca UTSW 1 90142731 missense probably null 0.97
R0961:Iqca UTSW 1 90142731 missense probably null 0.97
R0962:Iqca UTSW 1 90142731 missense probably null 0.97
R0963:Iqca UTSW 1 90142731 missense probably null 0.97
R1101:Iqca UTSW 1 90142731 missense probably null 0.97
R1344:Iqca UTSW 1 90142731 missense probably null 0.97
R1523:Iqca UTSW 1 90142731 missense probably null 0.97
R1646:Iqca UTSW 1 90140038 missense probably damaging 0.98
R1682:Iqca UTSW 1 90142731 missense probably null 0.97
R1742:Iqca UTSW 1 90098051 missense probably benign 0.01
R1774:Iqca UTSW 1 90080903 missense probably benign 0.02
R1775:Iqca UTSW 1 90081416 missense probably damaging 1.00
R2011:Iqca UTSW 1 90045626 missense probably benign 0.00
R2065:Iqca UTSW 1 90130231 missense probably benign 0.01
R2156:Iqca UTSW 1 90089516 missense possibly damaging 0.78
R2186:Iqca UTSW 1 90081344 missense probably benign 0.06
R3872:Iqca UTSW 1 90089481 missense probably damaging 1.00
R4308:Iqca UTSW 1 90144897 missense probably damaging 1.00
R4578:Iqca UTSW 1 90073750 missense probably damaging 0.98
R4737:Iqca UTSW 1 90077822 missense probably damaging 0.99
R4867:Iqca UTSW 1 90089504 missense probably benign 0.00
R4884:Iqca UTSW 1 90140037 missense probably benign 0.10
R4887:Iqca UTSW 1 90045701 missense probably damaging 1.00
R5352:Iqca UTSW 1 90130196 missense probably benign 0.00
R5733:Iqca UTSW 1 90070535 missense probably damaging 0.97
R5838:Iqca UTSW 1 90144945 missense probably benign 0.22
R5951:Iqca UTSW 1 90140097 splice site probably null
R5957:Iqca UTSW 1 90080948 missense probably damaging 1.00
R6696:Iqca UTSW 1 90130200 missense probably benign
R7240:Iqca UTSW 1 90070550 missense possibly damaging 0.88
R7769:Iqca UTSW 1 90077810 missense possibly damaging 0.82
R7841:Iqca UTSW 1 90059615 missense
R8069:Iqca UTSW 1 90045744 missense probably damaging 0.96
R8103:Iqca UTSW 1 90059608 missense
Z1176:Iqca UTSW 1 90045725 missense probably benign 0.26
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ccacaaacacccttacccac -3'
Posted On2013-10-16