Incidental Mutation 'R0825:Ghsr'
ID78166
Institutional Source Beutler Lab
Gene Symbol Ghsr
Ensembl Gene ENSMUSG00000051136
Gene Namegrowth hormone secretagogue receptor
SynonymsC530020I22Rik
MMRRC Submission 039005-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0825 (G1)
Quality Score215
Status Validated
Chromosome3
Chromosomal Location27371351-27378010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27374627 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 267 (V267A)
Ref Sequence ENSEMBL: ENSMUSP00000061153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057186]
Predicted Effect probably damaging
Transcript: ENSMUST00000057186
AA Change: V267A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000061153
Gene: ENSMUSG00000051136
AA Change: V267A

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
Pfam:7TM_GPCR_Srw 47 339 5.8e-12 PFAM
Pfam:7TM_GPCR_Srsx 53 336 9.4e-8 PFAM
Pfam:7tm_1 59 321 7.9e-51 PFAM
Pfam:7TM_GPCR_Srv 61 338 4.8e-9 PFAM
Meta Mutation Damage Score 0.4518 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor family. The encoded protein may play a role in energy homeostasis and regulation of body weight. Two identified transcript variants are expressed in several tissues and are evolutionary conserved in fish and swine. One transcript, 1a, excises an intron and encodes the functional protein; this protein is the receptor for the Ghrelin ligand and defines a neuroendocrine pathway for growth hormone release. The second transcript (1b) retains the intron and does not function as a receptor for Ghrelin; however, it may function to attenuate activity of isoform 1a. Mutations in this gene are associated with autosomal idiopathic short stature.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homeostasis is disrupted by inactivation of this gene, namely growth hormone release and appetite stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,400,577 I963N probably damaging Het
AF529169 G A 9: 89,603,279 Q22* probably null Het
Aox4 A G 1: 58,248,909 D727G possibly damaging Het
Arhgef26 T A 3: 62,426,593 I590N probably damaging Het
Arid1b T G 17: 5,342,178 C1994W probably damaging Het
Chd9 T C 8: 91,051,197 I2628T probably benign Het
Clspn G A 4: 126,573,130 probably benign Het
Cyp2a4 A T 7: 26,312,916 T375S probably benign Het
Dmtf1 A T 5: 9,130,388 M226K probably damaging Het
Erap1 T C 13: 74,674,614 probably benign Het
Frmpd1 A G 4: 45,285,394 D1405G possibly damaging Het
Gfm2 A T 13: 97,143,104 probably benign Het
Golga2 A C 2: 32,304,791 Q650P probably damaging Het
Hmgcl A G 4: 135,960,070 T219A probably benign Het
Ift27 C A 15: 78,165,136 probably benign Het
Igfn1 C T 1: 135,963,126 E2379K probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kpnb1 A T 11: 97,171,675 S421R probably damaging Het
Mtx3 C A 13: 92,850,341 T264K probably damaging Het
Nrg3 G A 14: 39,472,391 P137L possibly damaging Het
Nt5c2 A G 19: 46,898,905 probably benign Het
Olfr1391 T A 11: 49,327,682 H90Q probably benign Het
Olfr199 G T 16: 59,216,450 H54Q possibly damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd5 G A 7: 35,646,913 R91W possibly damaging Het
Pxdn G A 12: 29,984,996 probably benign Het
Rgl2 T A 17: 33,935,159 probably null Het
Rnf217 T C 10: 31,517,457 D376G probably damaging Het
Sept9 C T 11: 117,359,460 L519F probably damaging Het
Slc15a5 C T 6: 138,018,089 C386Y possibly damaging Het
Srrm4 T A 5: 116,453,713 I256F unknown Het
Stab1 G T 14: 31,152,600 D950E probably benign Het
Stim2 A G 5: 54,118,483 T667A probably benign Het
Strbp A T 2: 37,635,527 N144K probably benign Het
Sync A G 4: 129,293,397 Y74C probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tgfbi T C 13: 56,638,710 probably benign Het
Tmf1 A T 6: 97,175,995 N372K probably benign Het
Ubr4 G T 4: 139,479,576 probably null Het
Uggt1 A T 1: 36,158,143 N1226K probably benign Het
Ugt2b34 T C 5: 86,906,701 I74V possibly damaging Het
Wdfy3 A G 5: 101,870,051 L2541P probably damaging Het
Zfhx3 T G 8: 108,949,208 F2297V probably damaging Het
Other mutations in Ghsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ghsr APN 3 27374873 missense possibly damaging 0.92
IGL00435:Ghsr APN 3 27372383 missense possibly damaging 0.91
IGL01376:Ghsr APN 3 27371828 missense probably benign
IGL02444:Ghsr APN 3 27372040 missense probably benign 0.17
IGL02650:Ghsr APN 3 27374855 missense probably benign 0.29
IGL02754:Ghsr APN 3 27372496 missense probably damaging 1.00
R0571:Ghsr UTSW 3 27372016 missense probably damaging 1.00
R1036:Ghsr UTSW 3 27374720 missense probably damaging 0.98
R1462:Ghsr UTSW 3 27371876 missense probably benign 0.01
R1462:Ghsr UTSW 3 27371876 missense probably benign 0.01
R1529:Ghsr UTSW 3 27372482 missense probably damaging 1.00
R1598:Ghsr UTSW 3 27372277 missense probably benign 0.27
R4846:Ghsr UTSW 3 27371837 missense probably benign
R4951:Ghsr UTSW 3 27372361 missense possibly damaging 0.83
R4993:Ghsr UTSW 3 27372254 missense possibly damaging 0.87
R5055:Ghsr UTSW 3 27372272 missense probably benign 0.28
R6843:Ghsr UTSW 3 27372527 missense probably benign
R6936:Ghsr UTSW 3 27372325 missense probably benign 0.02
R7068:Ghsr UTSW 3 27371837 missense probably benign 0.01
R7318:Ghsr UTSW 3 27372467 missense possibly damaging 0.91
R7510:Ghsr UTSW 3 27372374 missense probably benign 0.05
R7889:Ghsr UTSW 3 27372166 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTGTTTCCTGTGTCAAAGAGCAAG -3'
(R):5'- ATCCCCAAACTGACGTTCTGCC -3'

Sequencing Primer
(F):5'- CAAAGAGCAAGATGTGATGTTTGTC -3'
(R):5'- TCTCATCCTTCAGAGTGGAAAGC -3'
Posted On2013-10-16