Mutagenetix > Incidental Mutation

Incidental Mutation 'R0825:Clspn'

78169

Institutional Source

Beutler Lab

Gene Symbol

Clspn

Ensembl Gene

ENSMUSG00000042489

Gene Name

claspin

Synonyms

C85083, E130314M08Rik

MMRRC Submission

039005-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0825 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

126556935-126593903 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 126573130 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048391]

AlphaFold

Q80YR7

Predicted Effect

probably benign
Transcript: ENSMUST00000048391

SMART Domains

Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489

Domain	Start	End	E-Value	Type
low complexity region	64	75	N/A	INTRINSIC
coiled coil region	159	187	N/A	INTRINSIC
low complexity region	214	230	N/A	INTRINSIC
low complexity region	232	245	N/A	INTRINSIC
low complexity region	477	490	N/A	INTRINSIC
coiled coil region	599	626	N/A	INTRINSIC
low complexity region	632	658	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	732	753	N/A	INTRINSIC
low complexity region	793	812	N/A	INTRINSIC
low complexity region	968	975	N/A	INTRINSIC
coiled coil region	1001	1036	N/A	INTRINSIC
low complexity region	1045	1064	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000126512

SMART Domains

Protein: ENSMUSP00000119437
Gene: ENSMUSG00000042489

Domain	Start	End	E-Value	Type
coiled coil region	74	101	N/A	INTRINSIC
low complexity region	108	147	N/A	INTRINSIC
low complexity region	153	170	N/A	INTRINSIC
low complexity region	221	242	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146944

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.4%
20x: 91.4%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	T	A	17: 24,400,577	I963N	probably damaging	Het
AF529169	G	A	9: 89,603,279	Q22*	probably null	Het
Aox4	A	G	1: 58,248,909	D727G	possibly damaging	Het
Arhgef26	T	A	3: 62,426,593	I590N	probably damaging	Het
Arid1b	T	G	17: 5,342,178	C1994W	probably damaging	Het
Chd9	T	C	8: 91,051,197	I2628T	probably benign	Het
Cyp2a4	A	T	7: 26,312,916	T375S	probably benign	Het
Dmtf1	A	T	5: 9,130,388	M226K	probably damaging	Het
Erap1	T	C	13: 74,674,614		probably benign	Het
Frmpd1	A	G	4: 45,285,394	D1405G	possibly damaging	Het
Gfm2	A	T	13: 97,143,104		probably benign	Het
Ghsr	T	C	3: 27,374,627	V267A	probably damaging	Het
Golga2	A	C	2: 32,304,791	Q650P	probably damaging	Het
Hmgcl	A	G	4: 135,960,070	T219A	probably benign	Het
Ift27	C	A	15: 78,165,136		probably benign	Het
Igfn1	C	T	1: 135,963,126	E2379K	probably damaging	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Kpnb1	A	T	11: 97,171,675	S421R	probably damaging	Het
Mtx3	C	A	13: 92,850,341	T264K	probably damaging	Het
Nrg3	G	A	14: 39,472,391	P137L	possibly damaging	Het
Nt5c2	A	G	19: 46,898,905		probably benign	Het
Olfr1391	T	A	11: 49,327,682	H90Q	probably benign	Het
Olfr199	G	T	16: 59,216,450	H54Q	possibly damaging	Het
Pcdhb2	G	A	18: 37,295,657	V228I	possibly damaging	Het
Pdcd5	G	A	7: 35,646,913	R91W	possibly damaging	Het
Pxdn	G	A	12: 29,984,996		probably benign	Het
Rgl2	T	A	17: 33,935,159		probably null	Het
Rnf217	T	C	10: 31,517,457	D376G	probably damaging	Het
Sept9	C	T	11: 117,359,460	L519F	probably damaging	Het
Slc15a5	C	T	6: 138,018,089	C386Y	possibly damaging	Het
Srrm4	T	A	5: 116,453,713	I256F	unknown	Het
Stab1	G	T	14: 31,152,600	D950E	probably benign	Het
Stim2	A	G	5: 54,118,483	T667A	probably benign	Het
Strbp	A	T	2: 37,635,527	N144K	probably benign	Het
Sync	A	G	4: 129,293,397	Y74C	probably benign	Het
Terb1	A	T	8: 104,468,748	M587K	possibly damaging	Het
Tgfbi	T	C	13: 56,638,710		probably benign	Het
Tmf1	A	T	6: 97,175,995	N372K	probably benign	Het
Ubr4	G	T	4: 139,479,576		probably null	Het
Uggt1	A	T	1: 36,158,143	N1226K	probably benign	Het
Ugt2b34	T	C	5: 86,906,701	I74V	possibly damaging	Het
Wdfy3	A	G	5: 101,870,051	L2541P	probably damaging	Het
Zfhx3	T	G	8: 108,949,208	F2297V	probably damaging	Het

Other mutations in Clspn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Clspn	APN	4	126573178	missense	probably damaging	1.00
IGL02160:Clspn	APN	4	126581510	missense	probably benign	0.21
IGL02231:Clspn	APN	4	126559228	missense	probably damaging	0.98
IGL02281:Clspn	APN	4	126565770	missense	possibly damaging	0.90
IGL02368:Clspn	APN	4	126566107	missense	probably benign
IGL03149:Clspn	APN	4	126576502	splice site	probably benign
Durch	UTSW	4	126580962	missense	probably damaging	0.99
R0012:Clspn	UTSW	4	126564929	unclassified	probably benign
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0207:Clspn	UTSW	4	126590598	missense	possibly damaging	0.82
R0270:Clspn	UTSW	4	126573236	missense	probably damaging	1.00
R1082:Clspn	UTSW	4	126577779	missense	possibly damaging	0.95
R1349:Clspn	UTSW	4	126563977	missense	probably benign
R1568:Clspn	UTSW	4	126581517	missense	probably benign	0.01
R1649:Clspn	UTSW	4	126566435	unclassified	probably benign
R1663:Clspn	UTSW	4	126565975	missense	probably benign	0.00
R2497:Clspn	UTSW	4	126572347	missense	possibly damaging	0.79
R3107:Clspn	UTSW	4	126591659	missense	probably benign	0.06
R3951:Clspn	UTSW	4	126576379	missense	probably damaging	1.00
R3953:Clspn	UTSW	4	126566437	frame shift	probably null
R3954:Clspn	UTSW	4	126566437	frame shift	probably null
R3956:Clspn	UTSW	4	126566437	frame shift	probably null
R4599:Clspn	UTSW	4	126581460	missense	probably benign	0.14
R4717:Clspn	UTSW	4	126560056	missense	probably damaging	1.00
R4853:Clspn	UTSW	4	126566555	missense	probably damaging	0.99
R4854:Clspn	UTSW	4	126575950	missense	probably benign
R4979:Clspn	UTSW	4	126578386	missense	probably damaging	1.00
R5363:Clspn	UTSW	4	126561786	missense	possibly damaging	0.58
R5531:Clspn	UTSW	4	126577773	missense	probably benign
R5614:Clspn	UTSW	4	126580962	missense	probably damaging	0.99
R5706:Clspn	UTSW	4	126578418	missense	probably damaging	1.00
R5806:Clspn	UTSW	4	126586106	missense	probably damaging	1.00
R6106:Clspn	UTSW	4	126590641	missense	probably benign	0.00
R6178:Clspn	UTSW	4	126577736	splice site	probably null
R6223:Clspn	UTSW	4	126586168	missense	probably damaging	0.99
R6326:Clspn	UTSW	4	126565739	missense	probably damaging	1.00
R6398:Clspn	UTSW	4	126563947	missense	probably damaging	1.00
R6714:Clspn	UTSW	4	126565768	missense	probably damaging	1.00
R7003:Clspn	UTSW	4	126592720	missense	possibly damaging	0.63
R7034:Clspn	UTSW	4	126580982	missense	possibly damaging	0.87
R7358:Clspn	UTSW	4	126566200	missense	probably benign	0.02
R7376:Clspn	UTSW	4	126590637	missense	possibly damaging	0.65
R7675:Clspn	UTSW	4	126566320	missense	probably benign	0.00
R8320:Clspn	UTSW	4	126563950	missense	possibly damaging	0.73
R8517:Clspn	UTSW	4	126566219	missense	probably benign	0.00
R8547:Clspn	UTSW	4	126561816	missense	probably damaging	1.00
R9106:Clspn	UTSW	4	126577450	intron	probably benign
R9223:Clspn	UTSW	4	126590618	missense	possibly damaging	0.60
R9361:Clspn	UTSW	4	126585861	missense	probably damaging	0.99
R9527:Clspn	UTSW	4	126559999	nonsense	probably null
R9717:Clspn	UTSW	4	126564963	missense	possibly damaging	0.90
T0975:Clspn	UTSW	4	126566437	unclassified	probably benign
X0014:Clspn	UTSW	4	126575943	missense	probably damaging	1.00
Z1177:Clspn	UTSW	4	126566177	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTGTCTACCTCATGACTTCTGAGCCA -3'
(R):5'- AACCTCCTGAATGTCTTGATCCTCCT -3'

Sequencing Primer
(F):5'- gccccttgcttgctaacc -3'
(R):5'- tcctcctcctcctcctctc -3'

Posted On

2013-10-16