Incidental Mutation 'R0825:Hmgcl'
ID78171
Institutional Source Beutler Lab
Gene Symbol Hmgcl
Ensembl Gene ENSMUSG00000028672
Gene Name3-hydroxy-3-methylglutaryl-Coenzyme A lyase
Synonyms
MMRRC Submission 039005-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0825 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location135946448-135962617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135960070 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 219 (T219A)
Ref Sequence ENSEMBL: ENSMUSP00000030432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030432] [ENSMUST00000102541] [ENSMUST00000143304] [ENSMUST00000149636]
Predicted Effect probably benign
Transcript: ENSMUST00000030432
AA Change: T219A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030432
Gene: ENSMUSG00000028672
AA Change: T219A

DomainStartEndE-ValueType
Pfam:HMGL-like 32 306 2.4e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102541
SMART Domains Protein: ENSMUSP00000099600
Gene: ENSMUSG00000028671

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 1 184 3.5e-14 PFAM
Pfam:KR 3 144 9.5e-10 PFAM
Pfam:Polysacc_synt_2 4 193 7.6e-14 PFAM
Pfam:Epimerase 4 269 3.5e-54 PFAM
Pfam:3Beta_HSD 5 172 2e-18 PFAM
Pfam:GDP_Man_Dehyd 5 332 2.5e-60 PFAM
Pfam:NAD_binding_4 62 233 2.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135644
Predicted Effect probably benign
Transcript: ENSMUST00000143304
SMART Domains Protein: ENSMUSP00000119514
Gene: ENSMUSG00000028671

DomainStartEndE-ValueType
Pfam:Epimerase 4 55 1.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148613
Predicted Effect probably benign
Transcript: ENSMUST00000149636
SMART Domains Protein: ENSMUSP00000117923
Gene: ENSMUSG00000028671

DomainStartEndE-ValueType
Pfam:Epimerase 4 58 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151879
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the HMG-CoA lyase family. It is a mitochondrial enzyme that catalyzes the final step of leucine degradation and plays a key role in ketone body formation. Mutations in this gene are associated with HMG-CoA lyase deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele die at midgestation exhibiting reduced embryo size, frequent cytoplasmic vacuolization in liver, heart and placenta, and marked focal hydropic swelling of mitochondria in hepatocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,400,577 I963N probably damaging Het
AF529169 G A 9: 89,603,279 Q22* probably null Het
Aox4 A G 1: 58,248,909 D727G possibly damaging Het
Arhgef26 T A 3: 62,426,593 I590N probably damaging Het
Arid1b T G 17: 5,342,178 C1994W probably damaging Het
Chd9 T C 8: 91,051,197 I2628T probably benign Het
Clspn G A 4: 126,573,130 probably benign Het
Cyp2a4 A T 7: 26,312,916 T375S probably benign Het
Dmtf1 A T 5: 9,130,388 M226K probably damaging Het
Erap1 T C 13: 74,674,614 probably benign Het
Frmpd1 A G 4: 45,285,394 D1405G possibly damaging Het
Gfm2 A T 13: 97,143,104 probably benign Het
Ghsr T C 3: 27,374,627 V267A probably damaging Het
Golga2 A C 2: 32,304,791 Q650P probably damaging Het
Ift27 C A 15: 78,165,136 probably benign Het
Igfn1 C T 1: 135,963,126 E2379K probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kpnb1 A T 11: 97,171,675 S421R probably damaging Het
Mtx3 C A 13: 92,850,341 T264K probably damaging Het
Nrg3 G A 14: 39,472,391 P137L possibly damaging Het
Nt5c2 A G 19: 46,898,905 probably benign Het
Olfr1391 T A 11: 49,327,682 H90Q probably benign Het
Olfr199 G T 16: 59,216,450 H54Q possibly damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd5 G A 7: 35,646,913 R91W possibly damaging Het
Pxdn G A 12: 29,984,996 probably benign Het
Rgl2 T A 17: 33,935,159 probably null Het
Rnf217 T C 10: 31,517,457 D376G probably damaging Het
Sept9 C T 11: 117,359,460 L519F probably damaging Het
Slc15a5 C T 6: 138,018,089 C386Y possibly damaging Het
Srrm4 T A 5: 116,453,713 I256F unknown Het
Stab1 G T 14: 31,152,600 D950E probably benign Het
Stim2 A G 5: 54,118,483 T667A probably benign Het
Strbp A T 2: 37,635,527 N144K probably benign Het
Sync A G 4: 129,293,397 Y74C probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tgfbi T C 13: 56,638,710 probably benign Het
Tmf1 A T 6: 97,175,995 N372K probably benign Het
Ubr4 G T 4: 139,479,576 probably null Het
Uggt1 A T 1: 36,158,143 N1226K probably benign Het
Ugt2b34 T C 5: 86,906,701 I74V possibly damaging Het
Wdfy3 A G 5: 101,870,051 L2541P probably damaging Het
Zfhx3 T G 8: 108,949,208 F2297V probably damaging Het
Other mutations in Hmgcl
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0226:Hmgcl UTSW 4 135958728 missense probably damaging 1.00
R2400:Hmgcl UTSW 4 135952368 splice site probably null
R3791:Hmgcl UTSW 4 135959987 missense probably benign 0.00
R4063:Hmgcl UTSW 4 135958724 missense probably damaging 1.00
R5000:Hmgcl UTSW 4 135962200 missense probably benign 0.01
R5754:Hmgcl UTSW 4 135950587 missense probably damaging 0.98
R6024:Hmgcl UTSW 4 135955615 missense probably benign 0.09
R6658:Hmgcl UTSW 4 135955651 missense probably damaging 0.96
R6889:Hmgcl UTSW 4 135955642 missense probably benign 0.33
R7074:Hmgcl UTSW 4 135953867 missense probably benign 0.00
R7238:Hmgcl UTSW 4 135962113 missense possibly damaging 0.92
R7733:Hmgcl UTSW 4 135960083 missense probably benign 0.01
R7997:Hmgcl UTSW 4 135960009 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGCTGGTCCCTTCCACTGAAAC -3'
(R):5'- TGTGGCCTCATAGACATCTGCCTC -3'

Sequencing Primer
(F):5'- TTCCACTGAAACTGTCGGG -3'
(R):5'- CCTCATAGACATCTGCCTCAATAC -3'
Posted On2013-10-16