Incidental Mutation 'R0825:Srrm4'
ID78177
Institutional Source Beutler Lab
Gene Symbol Srrm4
Ensembl Gene ENSMUSG00000063919
Gene Nameserine/arginine repetitive matrix 4
SynonymsB230202K19Rik, fp, bv, nSR100, 1500001A10Rik, flopsy
MMRRC Submission 039005-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R0825 (G1)
Quality Score223
Status Validated
Chromosome5
Chromosomal Location116439275-116591817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116453713 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 256 (I256F)
Ref Sequence ENSEMBL: ENSMUSP00000075488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076124]
Predicted Effect unknown
Transcript: ENSMUST00000076124
AA Change: I256F
SMART Domains Protein: ENSMUSP00000075488
Gene: ENSMUSG00000063919
AA Change: I256F

DomainStartEndE-ValueType
low complexity region 102 202 N/A INTRINSIC
low complexity region 289 299 N/A INTRINSIC
Pfam:SRRM_C 455 518 4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201273
Predicted Effect unknown
Transcript: ENSMUST00000222119
AA Change: D58V
Meta Mutation Damage Score 0.1306 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SRRM4 promotes alternative splicing and inclusion of neural-specific exons in target mRNAs (Calarco et al., 2009 [PubMed 19737518]).[supplied by OMIM, Oct 2009]
PHENOTYPE: Most homozygous null mice die neonatally with respiratory defects while survivors show tremors, head tilt, circling, premature neurogenesis, altered neurite outgrowth, cortical layering and axon guidance. Homozygotes for a spontaneous deletion show inner ear hair cell, balance and hearing defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,400,577 I963N probably damaging Het
AF529169 G A 9: 89,603,279 Q22* probably null Het
Aox4 A G 1: 58,248,909 D727G possibly damaging Het
Arhgef26 T A 3: 62,426,593 I590N probably damaging Het
Arid1b T G 17: 5,342,178 C1994W probably damaging Het
Chd9 T C 8: 91,051,197 I2628T probably benign Het
Clspn G A 4: 126,573,130 probably benign Het
Cyp2a4 A T 7: 26,312,916 T375S probably benign Het
Dmtf1 A T 5: 9,130,388 M226K probably damaging Het
Erap1 T C 13: 74,674,614 probably benign Het
Frmpd1 A G 4: 45,285,394 D1405G possibly damaging Het
Gfm2 A T 13: 97,143,104 probably benign Het
Ghsr T C 3: 27,374,627 V267A probably damaging Het
Golga2 A C 2: 32,304,791 Q650P probably damaging Het
Hmgcl A G 4: 135,960,070 T219A probably benign Het
Ift27 C A 15: 78,165,136 probably benign Het
Igfn1 C T 1: 135,963,126 E2379K probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kpnb1 A T 11: 97,171,675 S421R probably damaging Het
Mtx3 C A 13: 92,850,341 T264K probably damaging Het
Nrg3 G A 14: 39,472,391 P137L possibly damaging Het
Nt5c2 A G 19: 46,898,905 probably benign Het
Olfr1391 T A 11: 49,327,682 H90Q probably benign Het
Olfr199 G T 16: 59,216,450 H54Q possibly damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd5 G A 7: 35,646,913 R91W possibly damaging Het
Pxdn G A 12: 29,984,996 probably benign Het
Rgl2 T A 17: 33,935,159 probably null Het
Rnf217 T C 10: 31,517,457 D376G probably damaging Het
Sept9 C T 11: 117,359,460 L519F probably damaging Het
Slc15a5 C T 6: 138,018,089 C386Y possibly damaging Het
Stab1 G T 14: 31,152,600 D950E probably benign Het
Stim2 A G 5: 54,118,483 T667A probably benign Het
Strbp A T 2: 37,635,527 N144K probably benign Het
Sync A G 4: 129,293,397 Y74C probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tgfbi T C 13: 56,638,710 probably benign Het
Tmf1 A T 6: 97,175,995 N372K probably benign Het
Ubr4 G T 4: 139,479,576 probably null Het
Uggt1 A T 1: 36,158,143 N1226K probably benign Het
Ugt2b34 T C 5: 86,906,701 I74V possibly damaging Het
Wdfy3 A G 5: 101,870,051 L2541P probably damaging Het
Zfhx3 T G 8: 108,949,208 F2297V probably damaging Het
Other mutations in Srrm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Srrm4 APN 5 116446557 missense possibly damaging 0.86
IGL01291:Srrm4 APN 5 116467569 missense unknown
IGL01873:Srrm4 APN 5 116591468 utr 5 prime probably benign
IGL02553:Srrm4 APN 5 116444565 unclassified probably benign
IGL03090:Srrm4 APN 5 116449584 utr 3 prime probably benign
ANU05:Srrm4 UTSW 5 116467569 missense unknown
R0285:Srrm4 UTSW 5 116467789 unclassified probably benign
R0386:Srrm4 UTSW 5 116482378 splice site probably benign
R0845:Srrm4 UTSW 5 116444885 splice site probably null
R1615:Srrm4 UTSW 5 116447300 unclassified probably benign
R1874:Srrm4 UTSW 5 116453506 utr 3 prime probably benign
R2037:Srrm4 UTSW 5 116467828 unclassified probably benign
R3522:Srrm4 UTSW 5 116446544 start codon destroyed probably null
R3968:Srrm4 UTSW 5 116444744 unclassified probably benign
R4507:Srrm4 UTSW 5 116446553 missense probably damaging 0.98
R4771:Srrm4 UTSW 5 116475175 critical splice donor site probably null
R4815:Srrm4 UTSW 5 116475190 missense unknown
R4817:Srrm4 UTSW 5 116477134 missense unknown
R5383:Srrm4 UTSW 5 116471260 unclassified probably benign
R5620:Srrm4 UTSW 5 116449613 utr 3 prime probably benign
R5639:Srrm4 UTSW 5 116591359 missense unknown
R6497:Srrm4 UTSW 5 116467491 missense unknown
R7029:Srrm4 UTSW 5 116444792 unclassified probably benign
R7166:Srrm4 UTSW 5 116471242 missense unknown
R7514:Srrm4 UTSW 5 116446511 missense probably damaging 0.98
Z1176:Srrm4 UTSW 5 116453419 nonsense probably null
Z1177:Srrm4 UTSW 5 116453636 missense unknown
Predicted Primers PCR Primer
(F):5'- CATGATGAGACAGTGAAATGTTGCTGC -3'
(R):5'- AGGTTAAGGGTGTCTACAGCCCTC -3'

Sequencing Primer
(F):5'- AATCGGAGGTGTTGCCAC -3'
(R):5'- GAATCTTCCAGTTCTTCTAGCAGGG -3'
Posted On2013-10-16