Incidental Mutation 'R0825:Tmf1'
ID78178
Institutional Source Beutler Lab
Gene Symbol Tmf1
Ensembl Gene ENSMUSG00000030059
Gene NameTATA element modulatory factor 1
Synonyms7030402D04Rik, LOC232286
MMRRC Submission 039005-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R0825 (G1)
Quality Score220
Status Validated
Chromosome6
Chromosomal Location97152997-97179122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97175995 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 372 (N372K)
Ref Sequence ENSEMBL: ENSMUSP00000120093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095664] [ENSMUST00000124173]
Predicted Effect probably benign
Transcript: ENSMUST00000095664
AA Change: N372K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093325
Gene: ENSMUSG00000030059
AA Change: N372K

DomainStartEndE-ValueType
low complexity region 111 122 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 194 211 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
coiled coil region 443 536 N/A INTRINSIC
Pfam:TMF_DNA_bd 540 613 5e-24 PFAM
low complexity region 697 715 N/A INTRINSIC
low complexity region 719 732 N/A INTRINSIC
low complexity region 803 821 N/A INTRINSIC
coiled coil region 823 894 N/A INTRINSIC
low complexity region 923 937 N/A INTRINSIC
Pfam:TMF_TATA_bd 972 1085 1.5e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124173
AA Change: N372K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120093
Gene: ENSMUSG00000030059
AA Change: N372K

DomainStartEndE-ValueType
low complexity region 111 122 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 194 211 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
coiled coil region 443 536 N/A INTRINSIC
Pfam:TMF_DNA_bd 540 613 1.4e-24 PFAM
low complexity region 697 715 N/A INTRINSIC
low complexity region 719 732 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with decreased testis weight, globozoospermia, absent acrosome, asthenozoospermia, and abnormal sperm midpiece morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,400,577 I963N probably damaging Het
AF529169 G A 9: 89,603,279 Q22* probably null Het
Aox4 A G 1: 58,248,909 D727G possibly damaging Het
Arhgef26 T A 3: 62,426,593 I590N probably damaging Het
Arid1b T G 17: 5,342,178 C1994W probably damaging Het
Chd9 T C 8: 91,051,197 I2628T probably benign Het
Clspn G A 4: 126,573,130 probably benign Het
Cyp2a4 A T 7: 26,312,916 T375S probably benign Het
Dmtf1 A T 5: 9,130,388 M226K probably damaging Het
Erap1 T C 13: 74,674,614 probably benign Het
Frmpd1 A G 4: 45,285,394 D1405G possibly damaging Het
Gfm2 A T 13: 97,143,104 probably benign Het
Ghsr T C 3: 27,374,627 V267A probably damaging Het
Golga2 A C 2: 32,304,791 Q650P probably damaging Het
Hmgcl A G 4: 135,960,070 T219A probably benign Het
Ift27 C A 15: 78,165,136 probably benign Het
Igfn1 C T 1: 135,963,126 E2379K probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kpnb1 A T 11: 97,171,675 S421R probably damaging Het
Mtx3 C A 13: 92,850,341 T264K probably damaging Het
Nrg3 G A 14: 39,472,391 P137L possibly damaging Het
Nt5c2 A G 19: 46,898,905 probably benign Het
Olfr1391 T A 11: 49,327,682 H90Q probably benign Het
Olfr199 G T 16: 59,216,450 H54Q possibly damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd5 G A 7: 35,646,913 R91W possibly damaging Het
Pxdn G A 12: 29,984,996 probably benign Het
Rgl2 T A 17: 33,935,159 probably null Het
Rnf217 T C 10: 31,517,457 D376G probably damaging Het
Sept9 C T 11: 117,359,460 L519F probably damaging Het
Slc15a5 C T 6: 138,018,089 C386Y possibly damaging Het
Srrm4 T A 5: 116,453,713 I256F unknown Het
Stab1 G T 14: 31,152,600 D950E probably benign Het
Stim2 A G 5: 54,118,483 T667A probably benign Het
Strbp A T 2: 37,635,527 N144K probably benign Het
Sync A G 4: 129,293,397 Y74C probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tgfbi T C 13: 56,638,710 probably benign Het
Ubr4 G T 4: 139,479,576 probably null Het
Uggt1 A T 1: 36,158,143 N1226K probably benign Het
Ugt2b34 T C 5: 86,906,701 I74V possibly damaging Het
Wdfy3 A G 5: 101,870,051 L2541P probably damaging Het
Zfhx3 T G 8: 108,949,208 F2297V probably damaging Het
Other mutations in Tmf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Tmf1 APN 6 97176494 missense probably benign 0.00
IGL00846:Tmf1 APN 6 97173316 missense possibly damaging 0.88
IGL01575:Tmf1 APN 6 97175936 missense probably damaging 1.00
IGL01922:Tmf1 APN 6 97176930 missense probably benign 0.00
IGL02550:Tmf1 APN 6 97158561 missense probably benign 0.28
IGL02675:Tmf1 APN 6 97164042 splice site probably benign
IGL02985:Tmf1 APN 6 97176809 missense probably damaging 1.00
IGL03324:Tmf1 APN 6 97163653 missense probably damaging 0.99
caddy UTSW 6 97161447 nonsense probably null
R0028:Tmf1 UTSW 6 97158098 missense probably damaging 1.00
R0153:Tmf1 UTSW 6 97170384 missense probably damaging 0.97
R0325:Tmf1 UTSW 6 97176504 missense possibly damaging 0.51
R0420:Tmf1 UTSW 6 97176141 missense probably damaging 1.00
R0730:Tmf1 UTSW 6 97176492 missense probably benign
R0827:Tmf1 UTSW 6 97158050 nonsense probably null
R0839:Tmf1 UTSW 6 97176323 missense probably damaging 1.00
R1078:Tmf1 UTSW 6 97173300 missense probably damaging 1.00
R1905:Tmf1 UTSW 6 97161479 missense possibly damaging 0.53
R2274:Tmf1 UTSW 6 97163586 missense probably damaging 1.00
R3701:Tmf1 UTSW 6 97172331 missense possibly damaging 0.51
R3953:Tmf1 UTSW 6 97176206 missense probably damaging 0.99
R3955:Tmf1 UTSW 6 97176206 missense probably damaging 0.99
R4398:Tmf1 UTSW 6 97178896 missense probably damaging 0.99
R4416:Tmf1 UTSW 6 97178988 missense probably damaging 1.00
R4497:Tmf1 UTSW 6 97172332 missense probably benign 0.00
R4592:Tmf1 UTSW 6 97173400 missense probably benign 0.00
R4669:Tmf1 UTSW 6 97170427 missense probably benign 0.00
R5214:Tmf1 UTSW 6 97167292 missense possibly damaging 0.81
R5352:Tmf1 UTSW 6 97176809 missense probably damaging 1.00
R5530:Tmf1 UTSW 6 97158087 missense probably damaging 1.00
R5815:Tmf1 UTSW 6 97173403 missense probably benign 0.28
R6806:Tmf1 UTSW 6 97161447 nonsense probably null
R6837:Tmf1 UTSW 6 97176581 missense possibly damaging 0.76
R6853:Tmf1 UTSW 6 97168849 missense probably damaging 0.99
R6887:Tmf1 UTSW 6 97176838 missense probably damaging 1.00
R7058:Tmf1 UTSW 6 97156950 missense probably damaging 1.00
R7145:Tmf1 UTSW 6 97176118 missense probably damaging 1.00
R7340:Tmf1 UTSW 6 97168100 missense possibly damaging 0.81
R7573:Tmf1 UTSW 6 97158494 missense probably benign 0.14
R7809:Tmf1 UTSW 6 97161459 missense probably damaging 0.99
R7833:Tmf1 UTSW 6 97161411 missense probably benign 0.06
R8728:Tmf1 UTSW 6 97156860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTTTTCAACAGCTTCACACTGC -3'
(R):5'- TCCCGAGTATAGCCGCTTAGATGAC -3'

Sequencing Primer
(F):5'- TCACACTGCTCAGTGGC -3'
(R):5'- GTATAGCCGCTTAGATGACTTCCAG -3'
Posted On2013-10-16