Incidental Mutation 'R0825:Rnf217'
Institutional Source Beutler Lab
Gene Symbol Rnf217
Ensembl Gene ENSMUSG00000063760
Gene Namering finger protein 217
MMRRC Submission 039005-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R0825 (G1)
Quality Score225
Status Validated
Chromosomal Location31493193-31609184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31517457 bp
Amino Acid Change Aspartic acid to Glycine at position 376 (D376G)
Ref Sequence ENSEMBL: ENSMUSP00000080650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081989]
Predicted Effect probably damaging
Transcript: ENSMUST00000081989
AA Change: D376G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080650
Gene: ENSMUSG00000063760
AA Change: D376G

low complexity region 9 23 N/A INTRINSIC
low complexity region 39 59 N/A INTRINSIC
low complexity region 97 121 N/A INTRINSIC
low complexity region 147 191 N/A INTRINSIC
RING 236 280 2.01e-1 SMART
IBR 301 369 2.66e-16 SMART
IBR 376 447 3.19e-1 SMART
RING 396 425 4.87e0 SMART
transmembrane domain 479 501 N/A INTRINSIC
Meta Mutation Damage Score 0.2647 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene is a member of the RING1-IBR-RING24 (RBR) ubiquitin protein ligase family, and it belongs to a subfamily of these proteins that contain a transmembrane domain. This protein can interact with the HAX1 anti-apoptotic protein via its C-terminal RING finger motif, which suggests a role in apoptosis signaling. It is thought that deregulation of this gene can be a mechanism in leukemogenesis. Mutations in the region encoding the protein GXXXG motif, which appears to be necessary for protein self-association, have been found in human cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,400,577 I963N probably damaging Het
AF529169 G A 9: 89,603,279 Q22* probably null Het
Aox4 A G 1: 58,248,909 D727G possibly damaging Het
Arhgef26 T A 3: 62,426,593 I590N probably damaging Het
Arid1b T G 17: 5,342,178 C1994W probably damaging Het
Chd9 T C 8: 91,051,197 I2628T probably benign Het
Clspn G A 4: 126,573,130 probably benign Het
Cyp2a4 A T 7: 26,312,916 T375S probably benign Het
Dmtf1 A T 5: 9,130,388 M226K probably damaging Het
Erap1 T C 13: 74,674,614 probably benign Het
Frmpd1 A G 4: 45,285,394 D1405G possibly damaging Het
Gfm2 A T 13: 97,143,104 probably benign Het
Ghsr T C 3: 27,374,627 V267A probably damaging Het
Golga2 A C 2: 32,304,791 Q650P probably damaging Het
Hmgcl A G 4: 135,960,070 T219A probably benign Het
Ift27 C A 15: 78,165,136 probably benign Het
Igfn1 C T 1: 135,963,126 E2379K probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kpnb1 A T 11: 97,171,675 S421R probably damaging Het
Mtx3 C A 13: 92,850,341 T264K probably damaging Het
Nrg3 G A 14: 39,472,391 P137L possibly damaging Het
Nt5c2 A G 19: 46,898,905 probably benign Het
Olfr1391 T A 11: 49,327,682 H90Q probably benign Het
Olfr199 G T 16: 59,216,450 H54Q possibly damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd5 G A 7: 35,646,913 R91W possibly damaging Het
Pxdn G A 12: 29,984,996 probably benign Het
Rgl2 T A 17: 33,935,159 probably null Het
Sept9 C T 11: 117,359,460 L519F probably damaging Het
Slc15a5 C T 6: 138,018,089 C386Y possibly damaging Het
Srrm4 T A 5: 116,453,713 I256F unknown Het
Stab1 G T 14: 31,152,600 D950E probably benign Het
Stim2 A G 5: 54,118,483 T667A probably benign Het
Strbp A T 2: 37,635,527 N144K probably benign Het
Sync A G 4: 129,293,397 Y74C probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tgfbi T C 13: 56,638,710 probably benign Het
Tmf1 A T 6: 97,175,995 N372K probably benign Het
Ubr4 G T 4: 139,479,576 probably null Het
Uggt1 A T 1: 36,158,143 N1226K probably benign Het
Ugt2b34 T C 5: 86,906,701 I74V possibly damaging Het
Wdfy3 A G 5: 101,870,051 L2541P probably damaging Het
Zfhx3 T G 8: 108,949,208 F2297V probably damaging Het
Other mutations in Rnf217
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Rnf217 APN 10 31503774 missense probably damaging 0.99
IGL01102:Rnf217 APN 10 31608503 missense probably damaging 0.97
IGL02160:Rnf217 APN 10 31505771 critical splice donor site probably null
R0582:Rnf217 UTSW 10 31608767 missense possibly damaging 0.88
R1606:Rnf217 UTSW 10 31534811 missense possibly damaging 0.93
R3715:Rnf217 UTSW 10 31534732 nonsense probably null
R3809:Rnf217 UTSW 10 31503808 missense possibly damaging 0.52
R4533:Rnf217 UTSW 10 31608763 missense possibly damaging 0.73
R4606:Rnf217 UTSW 10 31517476 nonsense probably null
R4937:Rnf217 UTSW 10 31517524 missense probably benign
R6683:Rnf217 UTSW 10 31534826 missense possibly damaging 0.92
R6940:Rnf217 UTSW 10 31505977 splice site probably null
R7751:Rnf217 UTSW 10 31517419 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- agttcctacccttatttcccttc -3'
Posted On2013-10-16