Incidental Mutation 'R0825:Sept9'
ID78188
Institutional Source Beutler Lab
Gene Symbol Sept9
Ensembl Gene ENSMUSG00000059248
Gene Nameseptin 9
SynonymsPNUTL4, Msf, Sint1, SL3-3 integration site 1, MSF1
MMRRC Submission 039005-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0825 (G1)
Quality Score217
Status Validated
Chromosome11
Chromosomal Location117199661-117362325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 117359460 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 519 (L519F)
Ref Sequence ENSEMBL: ENSMUSP00000101961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019038] [ENSMUST00000093907] [ENSMUST00000100193] [ENSMUST00000106349] [ENSMUST00000106354] [ENSMUST00000127383]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019038
AA Change: L530F

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019038
Gene: ENSMUSG00000059248
AA Change: L530F

DomainStartEndE-ValueType
Pfam:DUF258 265 379 5.3e-8 PFAM
Pfam:Septin 286 565 1.2e-112 PFAM
Pfam:GTP_EFTU 289 365 1.5e-5 PFAM
Pfam:AIG1 290 379 3.1e-7 PFAM
Pfam:MMR_HSR1 291 481 1.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093907
AA Change: L537F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091435
Gene: ENSMUSG00000059248
AA Change: L537F

DomainStartEndE-ValueType
Pfam:Septin 293 572 1.6e-112 PFAM
Pfam:MMR_HSR1 298 444 3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100193
AA Change: L288F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097767
Gene: ENSMUSG00000059248
AA Change: L288F

DomainStartEndE-ValueType
Pfam:DUF258 23 138 1.1e-8 PFAM
Pfam:Septin 44 323 3.4e-113 PFAM
Pfam:GTP_EFTU 47 123 6.2e-6 PFAM
Pfam:AIG1 48 138 2.4e-7 PFAM
Pfam:MMR_HSR1 49 194 4.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106349
AA Change: L288F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101956
Gene: ENSMUSG00000059248
AA Change: L288F

DomainStartEndE-ValueType
Pfam:DUF258 23 138 1.1e-8 PFAM
Pfam:Septin 44 323 3.4e-113 PFAM
Pfam:GTP_EFTU 47 123 6.2e-6 PFAM
Pfam:AIG1 48 138 2.4e-7 PFAM
Pfam:MMR_HSR1 49 194 4.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106354
AA Change: L519F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101961
Gene: ENSMUSG00000059248
AA Change: L519F

DomainStartEndE-ValueType
Pfam:DUF258 254 368 4.2e-8 PFAM
Pfam:Septin 275 554 3.4e-113 PFAM
Pfam:GTP_EFTU 278 354 3.7e-6 PFAM
Pfam:AIG1 279 368 1.9e-7 PFAM
Pfam:MMR_HSR1 280 378 7.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127383
SMART Domains Protein: ENSMUSP00000120065
Gene: ENSMUSG00000059248

DomainStartEndE-ValueType
Pfam:DUF258 43 158 1.2e-8 PFAM
Pfam:Septin 63 242 6.2e-79 PFAM
Pfam:GTP_EFTU 66 142 9.2e-7 PFAM
Pfam:AIG1 67 161 4.2e-8 PFAM
Pfam:MMR_HSR1 68 222 8.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155331
Meta Mutation Damage Score 0.2938 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality around E10 with generalized apoptotic degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,400,577 I963N probably damaging Het
AF529169 G A 9: 89,603,279 Q22* probably null Het
Aox4 A G 1: 58,248,909 D727G possibly damaging Het
Arhgef26 T A 3: 62,426,593 I590N probably damaging Het
Arid1b T G 17: 5,342,178 C1994W probably damaging Het
Chd9 T C 8: 91,051,197 I2628T probably benign Het
Clspn G A 4: 126,573,130 probably benign Het
Cyp2a4 A T 7: 26,312,916 T375S probably benign Het
Dmtf1 A T 5: 9,130,388 M226K probably damaging Het
Erap1 T C 13: 74,674,614 probably benign Het
Frmpd1 A G 4: 45,285,394 D1405G possibly damaging Het
Gfm2 A T 13: 97,143,104 probably benign Het
Ghsr T C 3: 27,374,627 V267A probably damaging Het
Golga2 A C 2: 32,304,791 Q650P probably damaging Het
Hmgcl A G 4: 135,960,070 T219A probably benign Het
Ift27 C A 15: 78,165,136 probably benign Het
Igfn1 C T 1: 135,963,126 E2379K probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kpnb1 A T 11: 97,171,675 S421R probably damaging Het
Mtx3 C A 13: 92,850,341 T264K probably damaging Het
Nrg3 G A 14: 39,472,391 P137L possibly damaging Het
Nt5c2 A G 19: 46,898,905 probably benign Het
Olfr1391 T A 11: 49,327,682 H90Q probably benign Het
Olfr199 G T 16: 59,216,450 H54Q possibly damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd5 G A 7: 35,646,913 R91W possibly damaging Het
Pxdn G A 12: 29,984,996 probably benign Het
Rgl2 T A 17: 33,935,159 probably null Het
Rnf217 T C 10: 31,517,457 D376G probably damaging Het
Slc15a5 C T 6: 138,018,089 C386Y possibly damaging Het
Srrm4 T A 5: 116,453,713 I256F unknown Het
Stab1 G T 14: 31,152,600 D950E probably benign Het
Stim2 A G 5: 54,118,483 T667A probably benign Het
Strbp A T 2: 37,635,527 N144K probably benign Het
Sync A G 4: 129,293,397 Y74C probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tgfbi T C 13: 56,638,710 probably benign Het
Tmf1 A T 6: 97,175,995 N372K probably benign Het
Ubr4 G T 4: 139,479,576 probably null Het
Uggt1 A T 1: 36,158,143 N1226K probably benign Het
Ugt2b34 T C 5: 86,906,701 I74V possibly damaging Het
Wdfy3 A G 5: 101,870,051 L2541P probably damaging Het
Zfhx3 T G 8: 108,949,208 F2297V probably damaging Het
Other mutations in Sept9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Sept9 APN 11 117352184 missense probably damaging 1.00
IGL00230:Sept9 APN 11 117354804 unclassified probably benign
IGL01520:Sept9 APN 11 117352643 missense probably damaging 1.00
IGL01905:Sept9 APN 11 117218889 missense probably benign 0.07
IGL02502:Sept9 APN 11 117290662 missense probably damaging 1.00
R0325:Sept9 UTSW 11 117356632 missense probably damaging 0.99
R0845:Sept9 UTSW 11 117356325 unclassified probably benign
R1581:Sept9 UTSW 11 117290595 missense probably damaging 1.00
R1763:Sept9 UTSW 11 117290428 missense probably benign 0.04
R1848:Sept9 UTSW 11 117353083 unclassified probably benign
R2039:Sept9 UTSW 11 117351617 missense probably damaging 1.00
R2409:Sept9 UTSW 11 117360461 missense probably damaging 1.00
R2763:Sept9 UTSW 11 117326501 missense probably benign 0.05
R3545:Sept9 UTSW 11 117352673 missense probably damaging 1.00
R4062:Sept9 UTSW 11 117352265 missense probably damaging 1.00
R4601:Sept9 UTSW 11 117360484 missense probably damaging 1.00
R5139:Sept9 UTSW 11 117356685 missense possibly damaging 0.80
R5759:Sept9 UTSW 11 117352268 missense probably benign 0.15
R6062:Sept9 UTSW 11 117290800 missense possibly damaging 0.89
R6134:Sept9 UTSW 11 117352161 missense probably damaging 1.00
R6509:Sept9 UTSW 11 117290427 missense probably benign
R7562:Sept9 UTSW 11 117326511 critical splice donor site probably null
R7573:Sept9 UTSW 11 117199745 start gained probably benign
R7592:Sept9 UTSW 11 117290662 missense probably damaging 1.00
R7810:Sept9 UTSW 11 117359438 nonsense probably null
R8200:Sept9 UTSW 11 117232716 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTGTCAATCATCCTGCCCAGTG -3'
(R):5'- GGCAACTTCTATCTATGGCCCACAC -3'

Sequencing Primer
(F):5'- AGCTGTTGGCTTTCCCGG -3'
(R):5'- ACATATAGTCCAGGCTGTGC -3'
Posted On2013-10-16