Incidental Mutation 'R0825:Tgfbi'
ID78192
Institutional Source Beutler Lab
Gene Symbol Tgfbi
Ensembl Gene ENSMUSG00000035493
Gene Nametransforming growth factor, beta induced
Synonyms68kDa, bIG-h3, Beta-ig
MMRRC Submission 039005-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R0825 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location56609523-56639562 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 56638710 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045173] [ENSMUST00000225600]
Predicted Effect probably benign
Transcript: ENSMUST00000045173
SMART Domains Protein: ENSMUSP00000037719
Gene: ENSMUSG00000035493

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 139 239 1.35e-33 SMART
FAS1 276 374 6.75e-34 SMART
FAS1 411 501 1.16e-14 SMART
FAS1 538 635 6.75e-34 SMART
low complexity region 656 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225600
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. This protein plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. The protein is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in this gene are associated with multiple types of corneal dystrophy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show delayed growth and are prone to spontaneous and induced tumors. Homozygotes for a second null allele are prone to STZ-induced diabetes and show impaired islet function under stress. Homozygotes for a third null allele show a transient decrease in retinal apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,400,577 I963N probably damaging Het
AF529169 G A 9: 89,603,279 Q22* probably null Het
Aox4 A G 1: 58,248,909 D727G possibly damaging Het
Arhgef26 T A 3: 62,426,593 I590N probably damaging Het
Arid1b T G 17: 5,342,178 C1994W probably damaging Het
Chd9 T C 8: 91,051,197 I2628T probably benign Het
Clspn G A 4: 126,573,130 probably benign Het
Cyp2a4 A T 7: 26,312,916 T375S probably benign Het
Dmtf1 A T 5: 9,130,388 M226K probably damaging Het
Erap1 T C 13: 74,674,614 probably benign Het
Frmpd1 A G 4: 45,285,394 D1405G possibly damaging Het
Gfm2 A T 13: 97,143,104 probably benign Het
Ghsr T C 3: 27,374,627 V267A probably damaging Het
Golga2 A C 2: 32,304,791 Q650P probably damaging Het
Hmgcl A G 4: 135,960,070 T219A probably benign Het
Ift27 C A 15: 78,165,136 probably benign Het
Igfn1 C T 1: 135,963,126 E2379K probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kpnb1 A T 11: 97,171,675 S421R probably damaging Het
Mtx3 C A 13: 92,850,341 T264K probably damaging Het
Nrg3 G A 14: 39,472,391 P137L possibly damaging Het
Nt5c2 A G 19: 46,898,905 probably benign Het
Olfr1391 T A 11: 49,327,682 H90Q probably benign Het
Olfr199 G T 16: 59,216,450 H54Q possibly damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd5 G A 7: 35,646,913 R91W possibly damaging Het
Pxdn G A 12: 29,984,996 probably benign Het
Rgl2 T A 17: 33,935,159 probably null Het
Rnf217 T C 10: 31,517,457 D376G probably damaging Het
Sept9 C T 11: 117,359,460 L519F probably damaging Het
Slc15a5 C T 6: 138,018,089 C386Y possibly damaging Het
Srrm4 T A 5: 116,453,713 I256F unknown Het
Stab1 G T 14: 31,152,600 D950E probably benign Het
Stim2 A G 5: 54,118,483 T667A probably benign Het
Strbp A T 2: 37,635,527 N144K probably benign Het
Sync A G 4: 129,293,397 Y74C probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tmf1 A T 6: 97,175,995 N372K probably benign Het
Ubr4 G T 4: 139,479,576 probably null Het
Uggt1 A T 1: 36,158,143 N1226K probably benign Het
Ugt2b34 T C 5: 86,906,701 I74V possibly damaging Het
Wdfy3 A G 5: 101,870,051 L2541P probably damaging Het
Zfhx3 T G 8: 108,949,208 F2297V probably damaging Het
Other mutations in Tgfbi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Tgfbi APN 13 56630595 missense probably benign 0.41
IGL02021:Tgfbi APN 13 56631353 missense probably damaging 1.00
IGL02325:Tgfbi APN 13 56631230 missense probably benign 0.00
PIT4486001:Tgfbi UTSW 13 56629794 missense probably damaging 0.98
R0008:Tgfbi UTSW 13 56629774 missense probably benign 0.00
R0122:Tgfbi UTSW 13 56627968 missense probably damaging 1.00
R0389:Tgfbi UTSW 13 56629702 missense probably benign 0.02
R0419:Tgfbi UTSW 13 56632193 splice site probably benign
R0432:Tgfbi UTSW 13 56632191 splice site probably benign
R0671:Tgfbi UTSW 13 56638726 missense probably null 1.00
R1263:Tgfbi UTSW 13 56630655 missense probably damaging 1.00
R1597:Tgfbi UTSW 13 56632191 splice site probably benign
R1864:Tgfbi UTSW 13 56632881 missense probably benign 0.16
R1940:Tgfbi UTSW 13 56614314 missense possibly damaging 0.92
R2570:Tgfbi UTSW 13 56638708 splice site probably null
R3111:Tgfbi UTSW 13 56609734 missense probably damaging 1.00
R3613:Tgfbi UTSW 13 56625726 missense probably damaging 1.00
R4815:Tgfbi UTSW 13 56632120 missense probably benign 0.45
R5847:Tgfbi UTSW 13 56636605 missense possibly damaging 0.94
R6314:Tgfbi UTSW 13 56626163 missense probably benign 0.01
R6810:Tgfbi UTSW 13 56637203 missense probably benign
R6821:Tgfbi UTSW 13 56626137 missense possibly damaging 0.95
R6943:Tgfbi UTSW 13 56637176 missense possibly damaging 0.77
R7165:Tgfbi UTSW 13 56628016 missense probably damaging 0.99
R7297:Tgfbi UTSW 13 56632113 missense possibly damaging 0.74
R7770:Tgfbi UTSW 13 56632844 splice site probably null
R7910:Tgfbi UTSW 13 56632184 missense probably damaging 1.00
R7914:Tgfbi UTSW 13 56629689 missense probably damaging 1.00
R8721:Tgfbi UTSW 13 56625786 missense probably benign 0.08
R8758:Tgfbi UTSW 13 56632081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTGGCTTCTGTGCCTGAGATTC -3'
(R):5'- GCCGGACTGCTTGATTCACATTTG -3'

Sequencing Primer
(F):5'- gcctgatggtacacaatcctaac -3'
(R):5'- GCTCAGATCTCAATATGGTGCAG -3'
Posted On2013-10-16