Incidental Mutation 'R0825:Gfm2'
ID78195
Institutional Source Beutler Lab
Gene Symbol Gfm2
Ensembl Gene ENSMUSG00000021666
Gene NameG elongation factor, mitochondrial 2
SynonymsEFG2, MST027, A930009M04Rik, 6530419G12Rik
MMRRC Submission 039005-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.700) question?
Stock #R0825 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location97137937-97181195 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 97143104 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022170] [ENSMUST00000042084] [ENSMUST00000160139] [ENSMUST00000161639] [ENSMUST00000161825] [ENSMUST00000161913] [ENSMUST00000161929]
Predicted Effect probably benign
Transcript: ENSMUST00000022170
SMART Domains Protein: ENSMUSP00000022170
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 66 349 9.9e-64 PFAM
Pfam:GTP_EFTU_D2 379 446 4.3e-8 PFAM
low complexity region 447 473 N/A INTRINSIC
Pfam:EFG_II 482 556 3.9e-29 PFAM
EFG_IV 558 677 2.94e-17 SMART
EFG_C 679 766 1.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042084
SMART Domains Protein: ENSMUSP00000048373
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 324 4.6e-64 PFAM
Pfam:GTP_EFTU_D2 354 421 4.2e-8 PFAM
low complexity region 422 448 N/A INTRINSIC
Pfam:EFG_II 457 531 3.7e-29 PFAM
EFG_IV 533 652 2.94e-17 SMART
EFG_C 654 741 1.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160139
SMART Domains Protein: ENSMUSP00000124426
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 241 3.5e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161518
Predicted Effect probably benign
Transcript: ENSMUST00000161639
SMART Domains Protein: ENSMUSP00000125656
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 1.2e-68 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 558 4.5e-30 PFAM
EFG_IV 560 679 2.94e-17 SMART
EFG_C 681 768 1.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161825
SMART Domains Protein: ENSMUSP00000125088
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 2.3e-64 PFAM
Pfam:GTP_EFTU_D2 381 448 1.1e-8 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 558 7.1e-30 PFAM
EFG_IV 560 679 2.94e-17 SMART
EFG_C 681 738 3.46e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161843
Predicted Effect probably benign
Transcript: ENSMUST00000161913
SMART Domains Protein: ENSMUSP00000124253
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 3.3e-64 PFAM
Pfam:GTP_EFTU_D2 381 448 3.2e-8 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 532 2.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161929
SMART Domains Protein: ENSMUSP00000125306
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 94 1.2e-9 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotes contain two protein translational systems, one in the cytoplasm and one in the mitochondria. Mitochondrial translation is crucial for maintaining mitochondrial function and mutations in this system lead to a breakdown in the respiratory chain-oxidative phosphorylation system and to impaired maintenance of mitochondrial DNA. This gene encodes one of the mitochondrial translation elongation factors, which is a GTPase that plays a role at the termination of mitochondrial translation by mediating the disassembly of ribosomes from messenger RNA . Its role in the regulation of normal mitochondrial function and in disease states attributed to mitochondrial dysfunction is not known. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,400,577 I963N probably damaging Het
AF529169 G A 9: 89,603,279 Q22* probably null Het
Aox4 A G 1: 58,248,909 D727G possibly damaging Het
Arhgef26 T A 3: 62,426,593 I590N probably damaging Het
Arid1b T G 17: 5,342,178 C1994W probably damaging Het
Chd9 T C 8: 91,051,197 I2628T probably benign Het
Clspn G A 4: 126,573,130 probably benign Het
Cyp2a4 A T 7: 26,312,916 T375S probably benign Het
Dmtf1 A T 5: 9,130,388 M226K probably damaging Het
Erap1 T C 13: 74,674,614 probably benign Het
Frmpd1 A G 4: 45,285,394 D1405G possibly damaging Het
Ghsr T C 3: 27,374,627 V267A probably damaging Het
Golga2 A C 2: 32,304,791 Q650P probably damaging Het
Hmgcl A G 4: 135,960,070 T219A probably benign Het
Ift27 C A 15: 78,165,136 probably benign Het
Igfn1 C T 1: 135,963,126 E2379K probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kpnb1 A T 11: 97,171,675 S421R probably damaging Het
Mtx3 C A 13: 92,850,341 T264K probably damaging Het
Nrg3 G A 14: 39,472,391 P137L possibly damaging Het
Nt5c2 A G 19: 46,898,905 probably benign Het
Olfr1391 T A 11: 49,327,682 H90Q probably benign Het
Olfr199 G T 16: 59,216,450 H54Q possibly damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd5 G A 7: 35,646,913 R91W possibly damaging Het
Pxdn G A 12: 29,984,996 probably benign Het
Rgl2 T A 17: 33,935,159 probably null Het
Rnf217 T C 10: 31,517,457 D376G probably damaging Het
Sept9 C T 11: 117,359,460 L519F probably damaging Het
Slc15a5 C T 6: 138,018,089 C386Y possibly damaging Het
Srrm4 T A 5: 116,453,713 I256F unknown Het
Stab1 G T 14: 31,152,600 D950E probably benign Het
Stim2 A G 5: 54,118,483 T667A probably benign Het
Strbp A T 2: 37,635,527 N144K probably benign Het
Sync A G 4: 129,293,397 Y74C probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tgfbi T C 13: 56,638,710 probably benign Het
Tmf1 A T 6: 97,175,995 N372K probably benign Het
Ubr4 G T 4: 139,479,576 probably null Het
Uggt1 A T 1: 36,158,143 N1226K probably benign Het
Ugt2b34 T C 5: 86,906,701 I74V possibly damaging Het
Wdfy3 A G 5: 101,870,051 L2541P probably damaging Het
Zfhx3 T G 8: 108,949,208 F2297V probably damaging Het
Other mutations in Gfm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gfm2 APN 13 97155442 missense probably benign 0.38
IGL00781:Gfm2 APN 13 97149339 missense probably damaging 1.00
IGL00789:Gfm2 APN 13 97173058 unclassified probably benign
IGL00978:Gfm2 APN 13 97162977 missense probably benign 0.20
IGL01637:Gfm2 APN 13 97150409 missense probably damaging 1.00
IGL02318:Gfm2 APN 13 97162975 missense probably damaging 1.00
R1173:Gfm2 UTSW 13 97165200 splice site probably null
R1847:Gfm2 UTSW 13 97162934 missense probably benign 0.04
R1932:Gfm2 UTSW 13 97141967 missense probably damaging 0.96
R2104:Gfm2 UTSW 13 97171520 missense probably damaging 0.99
R2108:Gfm2 UTSW 13 97155442 missense probably benign 0.38
R2877:Gfm2 UTSW 13 97153249 missense possibly damaging 0.80
R2878:Gfm2 UTSW 13 97153249 missense possibly damaging 0.80
R2898:Gfm2 UTSW 13 97172961 missense possibly damaging 0.85
R3931:Gfm2 UTSW 13 97175024 missense probably benign 0.02
R4011:Gfm2 UTSW 13 97143100 splice site probably benign
R4831:Gfm2 UTSW 13 97165038 missense probably damaging 1.00
R4921:Gfm2 UTSW 13 97175676 missense probably damaging 0.99
R5182:Gfm2 UTSW 13 97162893 missense probably damaging 1.00
R5309:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R5310:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R5311:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R5339:Gfm2 UTSW 13 97175040 missense probably benign
R5594:Gfm2 UTSW 13 97165038 missense probably damaging 1.00
R5599:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R6014:Gfm2 UTSW 13 97151661 splice site probably null
R6041:Gfm2 UTSW 13 97172623 missense probably benign 0.11
R6108:Gfm2 UTSW 13 97149422 missense possibly damaging 0.79
R6345:Gfm2 UTSW 13 97162953 missense probably damaging 0.96
R6596:Gfm2 UTSW 13 97165149 missense probably damaging 1.00
R6937:Gfm2 UTSW 13 97163064 splice site probably null
R6958:Gfm2 UTSW 13 97146236 missense probably damaging 1.00
R6996:Gfm2 UTSW 13 97149360 missense probably damaging 1.00
R7291:Gfm2 UTSW 13 97175024 missense probably benign 0.02
R7365:Gfm2 UTSW 13 97143021 missense probably benign 0.06
R7456:Gfm2 UTSW 13 97145703 nonsense probably null
R7585:Gfm2 UTSW 13 97179032 missense probably benign 0.03
R7597:Gfm2 UTSW 13 97172578 missense probably benign 0.00
R7766:Gfm2 UTSW 13 97150400 missense probably damaging 1.00
R8290:Gfm2 UTSW 13 97145663 missense probably benign 0.00
R8321:Gfm2 UTSW 13 97162992 missense possibly damaging 0.80
R8372:Gfm2 UTSW 13 97165044 missense possibly damaging 0.94
R8385:Gfm2 UTSW 13 97165011 missense probably benign 0.41
R8404:Gfm2 UTSW 13 97162977 missense probably benign 0.20
Z1177:Gfm2 UTSW 13 97162992 missense possibly damaging 0.93
Z1177:Gfm2 UTSW 13 97162993 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGAACGCTGCCTTGTGTCACTG -3'
(R):5'- AGCTCATCAGAAGCCCTGGAGAG -3'

Sequencing Primer
(F):5'- tcttcgtgcttcagcctc -3'
(R):5'- GCCCTGGAGAGGAGGAAG -3'
Posted On2013-10-16