Incidental Mutation 'R0825:Olfr199'
ID78199
Institutional Source Beutler Lab
Gene Symbol Olfr199
Ensembl Gene ENSMUSG00000074996
Gene Nameolfactory receptor 199
SynonymsGA_x54KRFPKG5P-55430495-55429569, MOR182-14
MMRRC Submission 039005-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0825 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59214134-59219767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 59216450 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 54 (H54Q)
Ref Sequence ENSEMBL: ENSMUSP00000150643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099657] [ENSMUST00000214186]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099657
AA Change: H54Q

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097249
Gene: ENSMUSG00000074996
AA Change: H54Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.6e-6 PFAM
Pfam:7tm_1 41 290 4.7e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214186
AA Change: H54Q

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,400,577 I963N probably damaging Het
AF529169 G A 9: 89,603,279 Q22* probably null Het
Aox4 A G 1: 58,248,909 D727G possibly damaging Het
Arhgef26 T A 3: 62,426,593 I590N probably damaging Het
Arid1b T G 17: 5,342,178 C1994W probably damaging Het
Chd9 T C 8: 91,051,197 I2628T probably benign Het
Clspn G A 4: 126,573,130 probably benign Het
Cyp2a4 A T 7: 26,312,916 T375S probably benign Het
Dmtf1 A T 5: 9,130,388 M226K probably damaging Het
Erap1 T C 13: 74,674,614 probably benign Het
Frmpd1 A G 4: 45,285,394 D1405G possibly damaging Het
Gfm2 A T 13: 97,143,104 probably benign Het
Ghsr T C 3: 27,374,627 V267A probably damaging Het
Golga2 A C 2: 32,304,791 Q650P probably damaging Het
Hmgcl A G 4: 135,960,070 T219A probably benign Het
Ift27 C A 15: 78,165,136 probably benign Het
Igfn1 C T 1: 135,963,126 E2379K probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kpnb1 A T 11: 97,171,675 S421R probably damaging Het
Mtx3 C A 13: 92,850,341 T264K probably damaging Het
Nrg3 G A 14: 39,472,391 P137L possibly damaging Het
Nt5c2 A G 19: 46,898,905 probably benign Het
Olfr1391 T A 11: 49,327,682 H90Q probably benign Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd5 G A 7: 35,646,913 R91W possibly damaging Het
Pxdn G A 12: 29,984,996 probably benign Het
Rgl2 T A 17: 33,935,159 probably null Het
Rnf217 T C 10: 31,517,457 D376G probably damaging Het
Sept9 C T 11: 117,359,460 L519F probably damaging Het
Slc15a5 C T 6: 138,018,089 C386Y possibly damaging Het
Srrm4 T A 5: 116,453,713 I256F unknown Het
Stab1 G T 14: 31,152,600 D950E probably benign Het
Stim2 A G 5: 54,118,483 T667A probably benign Het
Strbp A T 2: 37,635,527 N144K probably benign Het
Sync A G 4: 129,293,397 Y74C probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tgfbi T C 13: 56,638,710 probably benign Het
Tmf1 A T 6: 97,175,995 N372K probably benign Het
Ubr4 G T 4: 139,479,576 probably null Het
Uggt1 A T 1: 36,158,143 N1226K probably benign Het
Ugt2b34 T C 5: 86,906,701 I74V possibly damaging Het
Wdfy3 A G 5: 101,870,051 L2541P probably damaging Het
Zfhx3 T G 8: 108,949,208 F2297V probably damaging Het
Other mutations in Olfr199
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr199 APN 16 59216496 missense probably damaging 0.97
IGL00972:Olfr199 APN 16 59216466 missense probably damaging 1.00
IGL01734:Olfr199 APN 16 59216429 missense probably benign 0.12
IGL01876:Olfr199 APN 16 59216019 missense possibly damaging 0.89
IGL02017:Olfr199 APN 16 59215947 missense probably damaging 1.00
IGL02871:Olfr199 APN 16 59216374 nonsense probably null
IGL03153:Olfr199 APN 16 59216203 missense probably benign 0.35
R0702:Olfr199 UTSW 16 59215699 missense probably benign
R1522:Olfr199 UTSW 16 59215984 missense probably damaging 1.00
R1769:Olfr199 UTSW 16 59215981 missense probably benign 0.01
R2144:Olfr199 UTSW 16 59216026 missense probably benign 0.00
R3956:Olfr199 UTSW 16 59216065 nonsense probably null
R4783:Olfr199 UTSW 16 59215859 missense probably damaging 0.98
R5534:Olfr199 UTSW 16 59216040 missense probably benign 0.39
R6031:Olfr199 UTSW 16 59215933 missense probably benign 0.00
R6031:Olfr199 UTSW 16 59215933 missense probably benign 0.00
R6141:Olfr199 UTSW 16 59216553 missense probably benign
R6445:Olfr199 UTSW 16 59216109 missense probably damaging 1.00
R6459:Olfr199 UTSW 16 59216020 missense probably benign 0.44
R6568:Olfr199 UTSW 16 59216278 missense probably benign 0.36
R7378:Olfr199 UTSW 16 59215920 missense probably benign 0.00
R7438:Olfr199 UTSW 16 59216398 missense probably benign 0.10
R8157:Olfr199 UTSW 16 59215989 missense probably benign
R8258:Olfr199 UTSW 16 59216095 missense probably benign 0.00
R8259:Olfr199 UTSW 16 59216095 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGAGCACCAAGTAAGTATGCCAC -3'
(R):5'- ATGGCAGAAGGAAACCGCACTC -3'

Sequencing Primer
(F):5'- GTATGCCACGGCTATAAACTG -3'
(R):5'- ACCGCACTCTGATCACTG -3'
Posted On2013-10-16